Mutagenetix > Incidental Mutation

Incidental Mutation 'R6108:Mmrn1'

485606

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

044258-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60975976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 414 (V414M)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129603
AA Change: V414M

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: V414M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204333
AA Change: V414M

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: V414M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,391,695	F5702L	probably damaging	Het
Aptx	G	A	4: 40,694,986	Q117*	probably null	Het
Axin1	T	A	17: 26,143,240	M186K	probably damaging	Het
Btbd2	A	T	10: 80,645,531	L249Q	probably damaging	Het
Caprin1	C	T	2: 103,776,017	V293I	possibly damaging	Het
Ccdc136	C	A	6: 29,412,450	H334Q	probably benign	Het
Ccdc180	A	G	4: 45,911,389	N568S	possibly damaging	Het
Cenpf	A	T	1: 189,662,013	F515L	probably benign	Het
Chrm2	T	A	6: 36,523,295	V29E	probably damaging	Het
Cnot1	A	G	8: 95,730,420	L1956P	probably damaging	Het
Cyp2d22	T	C	15: 82,371,905	K176R	possibly damaging	Het
Dnah7a	A	T	1: 53,456,845	I3151N	probably damaging	Het
Dsg1a	T	A	18: 20,340,247	D792E	probably benign	Het
Fam167b	A	T	4: 129,578,308	L23*	probably null	Het
Fermt3	C	A	19: 7,014,414	R143L	probably benign	Het
Gfm2	A	G	13: 97,149,422	I140V	possibly damaging	Het
Gna14	A	G	19: 16,603,343	T182A	probably damaging	Het
Hmcn1	A	G	1: 150,631,227	V3738A	possibly damaging	Het
Hspa4	C	T	11: 53,261,712	G810D	probably damaging	Het
Igf2bp3	A	G	6: 49,117,374	I154T	probably damaging	Het
Il1rap	G	A	16: 26,722,707	S566N	probably damaging	Het
Kcnb1	G	A	2: 167,105,140	T596M	probably damaging	Het
Kcnn1	A	C	8: 70,855,156	S81A	probably benign	Het
Lmod1	G	A	1: 135,364,111	G235R	probably benign	Het
Mei1	A	T	15: 82,075,188	R185S	possibly damaging	Het
Mon2	C	A	10: 123,032,695	M484I	probably benign	Het
Nae1	A	T	8: 104,527,402	D99E	probably benign	Het
Nsun7	T	A	5: 66,295,799	I619N	probably damaging	Het
Nudt12	C	A	17: 59,007,749	R280L	probably damaging	Het
Olfr365	T	C	2: 37,201,766	V175A	possibly damaging	Het
P2ry1	T	A	3: 61,004,175	I245N	probably damaging	Het
Plch1	C	T	3: 63,702,023	R912H	probably damaging	Het
Plek	T	A	11: 16,990,058	Y217F	probably damaging	Het
Plpp1	A	T	13: 112,866,865	I208F	possibly damaging	Het
Ptges3-ps	C	T	6: 85,844,555		noncoding transcript	Het
Ptprf	A	G	4: 118,223,256	L1267P	probably benign	Het
Ptprz1	A	T	6: 23,045,659	S2143C	probably damaging	Het
Scn9a	T	C	2: 66,484,049	D1764G	probably damaging	Het
Serpinb5	T	A	1: 106,881,728	L288Q	probably damaging	Het
Slc6a20b	T	G	9: 123,596,186	M539L	probably benign	Het
Slfnl1	A	G	4: 120,533,361	T70A	probably benign	Het
Smtn	C	A	11: 3,529,608	L486F	probably damaging	Het
Sptbn2	G	A	19: 4,731,392		probably null	Het
Tas2r144	C	A	6: 42,215,757	L144I	possibly damaging	Het
Tjp3	C	T	10: 81,281,146	R183K	probably benign	Het
Tnip3	A	G	6: 65,525,411		probably null	Het
Tspan12	T	A	6: 21,772,771	M212L	probably benign	Het
Ttn	T	A	2: 76,878,041		probably benign	Het
Vmn1r71	T	C	7: 10,748,618	M48V	probably benign	Het
Vmn2r10	A	G	5: 108,995,801	F761S	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr72	A	G	9: 74,151,668	T348A	probably damaging	Het
Xrn1	A	T	9: 95,974,427	L333F	possibly damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CAGCCTTTGTCACTGCAGTG -3'
(R):5'- CAAATGAGCTTGTTTTGCTTCC -3'

Sequencing Primer
(F):5'- GCAGTGAAAAGCATTTACCTTTTGCC -3'
(R):5'- GCTTCCAGTTCCTTGACAGG -3'

Posted On

2017-08-16