Incidental Mutation 'R6108:Kcnn1'
ID485609
Institutional Source Beutler Lab
Gene Symbol Kcnn1
Ensembl Gene ENSMUSG00000002908
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
SynonymsSK1
MMRRC Submission 044258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6108 (G1)
Quality Score194.009
Status Not validated
Chromosome8
Chromosomal Location70842049-70863258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70855156 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 81 (S81A)
Ref Sequence ENSEMBL: ENSMUSP00000148760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212086] [ENSMUST00000212243] [ENSMUST00000212414] [ENSMUST00000212509] [ENSMUST00000212611]
Predicted Effect probably benign
Transcript: ENSMUST00000110078
AA Change: S81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908
AA Change: S81A

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110081
AA Change: S81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908
AA Change: S81A

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212084
Predicted Effect probably benign
Transcript: ENSMUST00000212086
AA Change: S124A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000212243
Predicted Effect probably benign
Transcript: ENSMUST00000212414
AA Change: S81A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212509
AA Change: S81A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212611
AA Change: S81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal hippocampal morphology and afterhyperpolarization currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,391,695 F5702L probably damaging Het
Aptx G A 4: 40,694,986 Q117* probably null Het
Axin1 T A 17: 26,143,240 M186K probably damaging Het
Btbd2 A T 10: 80,645,531 L249Q probably damaging Het
Caprin1 C T 2: 103,776,017 V293I possibly damaging Het
Ccdc136 C A 6: 29,412,450 H334Q probably benign Het
Ccdc180 A G 4: 45,911,389 N568S possibly damaging Het
Cenpf A T 1: 189,662,013 F515L probably benign Het
Chrm2 T A 6: 36,523,295 V29E probably damaging Het
Cnot1 A G 8: 95,730,420 L1956P probably damaging Het
Cyp2d22 T C 15: 82,371,905 K176R possibly damaging Het
Dnah7a A T 1: 53,456,845 I3151N probably damaging Het
Dsg1a T A 18: 20,340,247 D792E probably benign Het
Fam167b A T 4: 129,578,308 L23* probably null Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Gfm2 A G 13: 97,149,422 I140V possibly damaging Het
Gna14 A G 19: 16,603,343 T182A probably damaging Het
Hmcn1 A G 1: 150,631,227 V3738A possibly damaging Het
Hspa4 C T 11: 53,261,712 G810D probably damaging Het
Igf2bp3 A G 6: 49,117,374 I154T probably damaging Het
Il1rap G A 16: 26,722,707 S566N probably damaging Het
Kcnb1 G A 2: 167,105,140 T596M probably damaging Het
Lmod1 G A 1: 135,364,111 G235R probably benign Het
Mei1 A T 15: 82,075,188 R185S possibly damaging Het
Mmrn1 G A 6: 60,975,976 V414M possibly damaging Het
Mon2 C A 10: 123,032,695 M484I probably benign Het
Nae1 A T 8: 104,527,402 D99E probably benign Het
Nsun7 T A 5: 66,295,799 I619N probably damaging Het
Nudt12 C A 17: 59,007,749 R280L probably damaging Het
Olfr365 T C 2: 37,201,766 V175A possibly damaging Het
P2ry1 T A 3: 61,004,175 I245N probably damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Plek T A 11: 16,990,058 Y217F probably damaging Het
Plpp1 A T 13: 112,866,865 I208F possibly damaging Het
Ptges3-ps C T 6: 85,844,555 noncoding transcript Het
Ptprf A G 4: 118,223,256 L1267P probably benign Het
Ptprz1 A T 6: 23,045,659 S2143C probably damaging Het
Scn9a T C 2: 66,484,049 D1764G probably damaging Het
Serpinb5 T A 1: 106,881,728 L288Q probably damaging Het
Slc6a20b T G 9: 123,596,186 M539L probably benign Het
Slfnl1 A G 4: 120,533,361 T70A probably benign Het
Smtn C A 11: 3,529,608 L486F probably damaging Het
Sptbn2 G A 19: 4,731,392 probably null Het
Tas2r144 C A 6: 42,215,757 L144I possibly damaging Het
Tjp3 C T 10: 81,281,146 R183K probably benign Het
Tnip3 A G 6: 65,525,411 probably null Het
Tspan12 T A 6: 21,772,771 M212L probably benign Het
Ttn T A 2: 76,878,041 probably benign Het
Vmn1r71 T C 7: 10,748,618 M48V probably benign Het
Vmn2r10 A G 5: 108,995,801 F761S probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr72 A G 9: 74,151,668 T348A probably damaging Het
Xrn1 A T 9: 95,974,427 L333F possibly damaging Het
Other mutations in Kcnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kcnn1 APN 8 70848062 missense probably benign
IGL00498:Kcnn1 APN 8 70852880 missense probably damaging 1.00
IGL00792:Kcnn1 APN 8 70854716 missense probably benign 0.01
IGL03122:Kcnn1 APN 8 70855080 missense probably damaging 1.00
IGL03137:Kcnn1 APN 8 70850737 missense probably damaging 0.97
IGL03222:Kcnn1 APN 8 70848199 missense probably damaging 1.00
IGL03226:Kcnn1 APN 8 70846491 splice site probably benign
R0586:Kcnn1 UTSW 8 70863869 unclassified probably benign
R1218:Kcnn1 UTSW 8 70852688 missense probably benign 0.07
R1437:Kcnn1 UTSW 8 70844551 missense probably benign 0.03
R1510:Kcnn1 UTSW 8 70864070 unclassified probably benign
R2434:Kcnn1 UTSW 8 70855166 small deletion probably benign
R2860:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R2861:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R4327:Kcnn1 UTSW 8 70852663 missense probably damaging 0.99
R4807:Kcnn1 UTSW 8 70848178 missense probably damaging 0.99
R4947:Kcnn1 UTSW 8 70844429 missense probably benign 0.02
R5265:Kcnn1 UTSW 8 70854653 missense probably benign 0.07
R5685:Kcnn1 UTSW 8 70852730 missense probably damaging 1.00
R6523:Kcnn1 UTSW 8 70846525 missense possibly damaging 0.57
R7512:Kcnn1 UTSW 8 70854649 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGCAGATGCCTACCTTGGTG -3'
(R):5'- TCCATTCAGAAGCTCTGCTGC -3'

Sequencing Primer
(F):5'- AGCAGATGCCTACCTTGGTGTATAC -3'
(R):5'- TCAGAAGCTCTGCTGCGGAAC -3'
Posted On2017-08-16