Incidental Mutation 'R0521:Col13a1'
ID48561
Institutional Source Beutler Lab
Gene Symbol Col13a1
Ensembl Gene ENSMUSG00000058806
Gene Namecollagen, type XIII, alpha 1
Synonyms
MMRRC Submission 038714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0521 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location61838236-61979108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61862746 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 512 (M512K)
Ref Sequence ENSEMBL: ENSMUSP00000101094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105451
Predicted Effect unknown
Transcript: ENSMUST00000105452
AA Change: M503K
SMART Domains Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806
AA Change: M503K

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Pfam:Collagen 154 214 1.6e-12 PFAM
Pfam:Collagen 255 319 1.8e-10 PFAM
Pfam:Collagen 283 338 7.8e-11 PFAM
Pfam:Collagen 313 376 6.8e-10 PFAM
Pfam:Collagen 377 436 3e-10 PFAM
Pfam:Collagen 458 517 4.3e-12 PFAM
Pfam:Collagen 498 559 7.7e-12 PFAM
Pfam:Collagen 557 616 1.6e-11 PFAM
Pfam:Collagen 587 666 9.8e-8 PFAM
Pfam:Collagen 635 704 4e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105453
AA Change: M481K
SMART Domains Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806
AA Change: M481K

DomainStartEndE-ValueType
internal_repeat_5 17 30 7.25e-5 PROSPERO
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
internal_repeat_5 140 153 7.25e-5 PROSPERO
Pfam:Collagen 154 214 1.5e-12 PFAM
Pfam:Collagen 235 296 1e-10 PFAM
internal_repeat_2 297 328 1.33e-8 PROSPERO
internal_repeat_1 297 332 1.43e-12 PROSPERO
Pfam:Collagen 355 414 2.8e-10 PFAM
Pfam:Collagen 436 495 4.6e-12 PFAM
Pfam:Collagen 477 551 3.6e-8 PFAM
Pfam:Collagen 536 606 5.1e-10 PFAM
Pfam:Collagen 574 670 1.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105454
AA Change: M512K
SMART Domains Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806
AA Change: M512K

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
Pfam:Collagen 112 161 6.7e-9 PFAM
Pfam:Collagen 164 223 1.5e-11 PFAM
Pfam:Collagen 264 328 6.7e-10 PFAM
Pfam:Collagen 292 347 2.8e-10 PFAM
Pfam:Collagen 322 385 2.3e-9 PFAM
Pfam:Collagen 386 445 1.1e-9 PFAM
Pfam:Collagen 467 526 1.6e-11 PFAM
Pfam:Collagen 507 582 4.8e-9 PFAM
Pfam:Collagen 564 630 5.4e-9 PFAM
low complexity region 671 695 N/A INTRINSIC
internal_repeat_2 698 723 7.38e-7 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000145469
AA Change: M52K
SMART Domains Protein: ENSMUSP00000117248
Gene: ENSMUSG00000058806
AA Change: M52K

DomainStartEndE-ValueType
Pfam:Collagen 8 67 1.1e-12 PFAM
Pfam:Collagen 93 156 7.2e-12 PFAM
Pfam:Collagen 170 239 9.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Aadacl3 A T 4: 144,455,894 S335T probably damaging Het
Abcb1b G A 5: 8,864,238 A1203T probably damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Angel1 G A 12: 86,722,907 S193F probably benign Het
Ankrd16 T C 2: 11,789,881 V359A probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Armc4 G A 18: 7,222,676 P531L possibly damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Bpifa5 C A 2: 154,166,949 D223E probably benign Het
C87499 A T 4: 88,629,322 N37K probably damaging Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Ccm2 G A 11: 6,590,886 S184N probably damaging Het
Ces5a T A 8: 93,525,658 D202V probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Cog7 C A 7: 121,941,169 probably null Het
Cps1 A C 1: 67,215,564 D1304A probably benign Het
Crhbp C A 13: 95,443,895 probably null Het
Ctdspl2 T A 2: 122,006,887 C377* probably null Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Ddost A G 4: 138,310,735 T262A probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx54 A G 5: 120,626,862 I769V probably benign Het
Dock1 T A 7: 135,143,778 I1463N probably benign Het
Dsg3 T A 18: 20,527,815 Y404N possibly damaging Het
Epb42 T A 2: 121,029,150 K186* probably null Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Farp2 A G 1: 93,576,821 probably null Het
Fev C A 1: 74,882,533 R86L possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Foxn3 A G 12: 99,209,506 V261A probably benign Het
Fsd1 A G 17: 55,991,245 D190G probably benign Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Gsdma2 A T 11: 98,654,901 K260* probably null Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hic1 G A 11: 75,166,887 P392L possibly damaging Het
Hk3 C T 13: 55,014,426 probably null Het
Ifna6 G T 4: 88,827,650 V79F probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kdm5b T A 1: 134,618,033 S977R possibly damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Lrrc29 A T 8: 105,312,793 L617Q probably damaging Het
Map1a T G 2: 121,305,753 L2350R probably damaging Het
Mdfic A G 6: 15,799,756 D212G probably benign Het
Ms4a1 C A 19: 11,258,679 probably null Het
Myo9a T A 9: 59,894,352 F1944L probably damaging Het
Nbea A T 3: 56,008,268 W928R probably damaging Het
Nfatc2ip T G 7: 126,396,579 D46A possibly damaging Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nsd2 T A 5: 33,843,338 N66K probably damaging Het
Nsmce4a T C 7: 130,537,002 H304R probably damaging Het
Olfr1099 C T 2: 86,958,846 G204D probably damaging Het
Olfr1239 T C 2: 89,418,200 Y71C probably damaging Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr859 G A 9: 19,808,860 V181I probably benign Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
R3hdm1 G A 1: 128,193,703 V315I probably benign Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Thnsl2 A T 6: 71,134,259 D208E probably damaging Het
Tie1 A C 4: 118,476,146 I841R probably damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tnfaip8l1 A T 17: 56,171,727 T6S probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Vmn2r9 C A 5: 108,848,288 G165* probably null Het
Xkr6 A T 14: 63,819,422 I261F probably benign Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Yipf1 A G 4: 107,336,190 Y91C probably benign Het
Zfp442 T C 2: 150,411,249 D31G possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zfp804a C T 2: 82,259,417 Q1197* probably null Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Col13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Col13a1 APN 10 61864005 critical splice acceptor site probably null
IGL00936:Col13a1 APN 10 61876290 missense probably damaging 0.99
IGL00963:Col13a1 APN 10 61838697 utr 3 prime probably benign
IGL01801:Col13a1 APN 10 61843614 missense probably damaging 1.00
IGL02247:Col13a1 APN 10 61961345 missense probably damaging 1.00
IGL02296:Col13a1 APN 10 61862025 intron probably benign
IGL02430:Col13a1 APN 10 61874751 missense probably benign 0.26
IGL02884:Col13a1 APN 10 61905285 splice site probably benign
IGL03036:Col13a1 APN 10 61893913 critical splice donor site probably null
IGL03145:Col13a1 APN 10 61891261 missense probably benign 0.07
IGL03392:Col13a1 APN 10 61885711 missense possibly damaging 0.88
R0027:Col13a1 UTSW 10 61850161 missense unknown
R0440:Col13a1 UTSW 10 61867483 missense possibly damaging 0.85
R0518:Col13a1 UTSW 10 61862746 missense unknown
R0631:Col13a1 UTSW 10 61887350 nonsense probably null
R1311:Col13a1 UTSW 10 61864010 splice site probably benign
R1350:Col13a1 UTSW 10 61894069 splice site probably benign
R1572:Col13a1 UTSW 10 61866426 unclassified probably null
R2401:Col13a1 UTSW 10 61851162 missense unknown
R2883:Col13a1 UTSW 10 61978356 missense probably benign 0.23
R2906:Col13a1 UTSW 10 61860488 intron probably benign
R2964:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R2965:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R3703:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3704:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3844:Col13a1 UTSW 10 61850209 missense unknown
R3928:Col13a1 UTSW 10 61867525 unclassified probably benign
R3939:Col13a1 UTSW 10 61863082 missense unknown
R4327:Col13a1 UTSW 10 61863979 missense unknown
R4328:Col13a1 UTSW 10 61863979 missense unknown
R4329:Col13a1 UTSW 10 61863979 missense unknown
R4585:Col13a1 UTSW 10 61887245 splice site probably null
R4705:Col13a1 UTSW 10 61850165 missense unknown
R4864:Col13a1 UTSW 10 61862660 missense unknown
R5072:Col13a1 UTSW 10 61874018 splice site silent
R5074:Col13a1 UTSW 10 61874018 splice site silent
R5114:Col13a1 UTSW 10 61890101 missense possibly damaging 0.82
R5625:Col13a1 UTSW 10 61843609 missense unknown
R5664:Col13a1 UTSW 10 61851116 missense probably damaging 1.00
R5799:Col13a1 UTSW 10 61849140 intron probably benign
Z1177:Col13a1 UTSW 10 61905262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCAGCATTTATACGGTGAGTGG -3'
(R):5'- TTTCATGCAGTACCAGTGAGCCCAG -3'

Sequencing Primer
(F):5'- GTTTTCTGAACTCTGGAACAGC -3'
(R):5'- GTCCTTTGACCACCAAGCTTT -3'
Posted On2013-06-12