Mutagenetix > Incidental Mutation

Incidental Mutation 'R6119:Abtb2'

485640

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6119 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103702310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 484 (E484D)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: E484D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: E484D

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.0847

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	T	7: 27,565,713	R97*	probably null	Het
4930544D05Rik	G	A	11: 70,616,491	A121T	probably damaging	Het
Ankk1	A	T	9: 49,426,883	W37R	possibly damaging	Het
Arhgap11a	C	A	2: 113,834,350	M529I	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
Ddx47	T	C	6: 135,023,355	I438T	probably benign	Het
Dnhd1	A	G	7: 105,709,440	T3379A	probably benign	Het
Dusp3	A	G	11: 101,980,669		probably benign	Het
Dync1h1	A	G	12: 110,628,006	K1289E	possibly damaging	Het
Egf	A	T	3: 129,736,772	I247N	probably benign	Het
Erich1	A	G	8: 14,033,692	L126P	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fat3	T	A	9: 16,376,568	H553L	possibly damaging	Het
Gdpgp1	T	C	7: 80,238,992	L257P	probably damaging	Het
Gimap8	T	C	6: 48,658,954	I551T	possibly damaging	Het
Gnptab	C	A	10: 88,431,395	D449E	probably damaging	Het
Grb10	T	C	11: 11,933,551	D513G	probably damaging	Het
Grin1	T	G	2: 25,305,158	D283A	probably damaging	Het
Gtf2i	A	T	5: 134,287,057		probably null	Het
Ip6k3	A	G	17: 27,148,625	V199A	possibly damaging	Het
Kif17	T	A	4: 138,288,332	Y405*	probably null	Het
Lair1	T	C	7: 4,028,896	M71V	probably benign	Het
Mamdc2	G	A	19: 23,353,315	T376M	probably damaging	Het
Msra	G	A	14: 64,440,734	R38C	probably damaging	Het
Mthfd1	A	T	12: 76,303,673	I462F	probably damaging	Het
Mum1	A	G	10: 80,229,031	K32E	probably benign	Het
Nbr1	A	G	11: 101,567,112		probably null	Het
Neb	A	G	2: 52,220,931	M181T	probably benign	Het
Noxo1	A	G	17: 24,696,571		probably benign	Het
Olfr1124	A	T	2: 87,435,389	K301*	probably null	Het
Olfr1195	A	G	2: 88,683,591	I47T	probably damaging	Het
Olfr181	A	T	16: 58,926,532	I13N	possibly damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Optn	C	A	2: 5,021,323		probably null	Het
Pclo	A	G	5: 14,677,019		probably benign	Het
Ppp1r16b	A	G	2: 158,751,127	I209V	probably benign	Het
Prss12	A	G	3: 123,489,609	I517V	possibly damaging	Het
Ripor2	C	T	13: 24,614,644		probably benign	Het
Rmnd5b	A	G	11: 51,625,709	S274P	probably benign	Het
Sftpa1	T	A	14: 41,132,552	I32N	probably damaging	Het
Slc2a12	T	A	10: 22,665,347	I367N	probably damaging	Het
Sorcs1	T	C	19: 50,288,094	D340G	probably damaging	Het
Synj1	T	C	16: 90,938,989	K1359E	probably benign	Het
Tcf12	T	A	9: 71,868,265	E421V	probably damaging	Het
Tecta	A	T	9: 42,373,075	F905I	probably benign	Het
Tmem106a	T	A	11: 101,583,750	C58*	probably null	Het
Tmem131l	A	T	3: 83,898,382	F1585I	probably damaging	Het
Tnks2	T	C	19: 36,879,352	S208P	possibly damaging	Het
Trim50	A	G	5: 135,353,420	N42S	probably benign	Het
Tsc22d2	T	A	3: 58,460,253		probably benign	Het
Ttll3	T	A	6: 113,394,741	L23H	probably damaging	Het
Vmn1r10	A	G	6: 57,114,233	Y270C	probably benign	Het
Ypel3	T	C	7: 126,778,365	V74A	possibly damaging	Het
Zfp677	A	G	17: 21,397,808	T376A	possibly damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTATGGCAGAGGTTCTCCAC -3'
(R):5'- AGGGACTGTGACTGCTTCTC -3'

Sequencing Primer
(F):5'- AGGTTGAGAATCACTGCCC -3'
(R):5'- GCTTCTCCCACCCTAGCATAG -3'

Posted On

2017-08-16