Incidental Mutation 'R6119:Btd'
ID485681
Institutional Source Beutler Lab
Gene Symbol Btd
Ensembl Gene ENSMUSG00000021900
Gene Namebiotinidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31641028-31668579 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 31641108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000090147] [ENSMUST00000127204] [ENSMUST00000128629] [ENSMUST00000134626] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably benign
Transcript: ENSMUST00000022437
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090147
SMART Domains Protein: ENSMUSP00000087608
Gene: ENSMUSG00000021900

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:CN_hydrolase 63 287 3.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127204
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128629
SMART Domains Protein: ENSMUSP00000125890
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 10 58 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134626
SMART Domains Protein: ENSMUSP00000114879
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 67 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156189
Predicted Effect probably benign
Transcript: ENSMUST00000156431
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165955
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167066
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167175
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171414
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit behavioral/neurological defects, weakness, bone loss, weight loss, and alopecia when fed a biotin-deprived diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Btd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Btd APN 14 31667776 missense probably benign 0.00
IGL02728:Btd APN 14 31667362 missense probably benign 0.00
IGL02965:Btd APN 14 31667236 missense probably damaging 1.00
R1503:Btd UTSW 14 31667655 missense probably damaging 1.00
R1662:Btd UTSW 14 31666790 missense probably damaging 1.00
R1817:Btd UTSW 14 31662289 missense possibly damaging 0.95
R1868:Btd UTSW 14 31667309 missense probably benign 0.13
R2225:Btd UTSW 14 31667060 missense probably benign 0.00
R2418:Btd UTSW 14 31641136 critical splice donor site probably null
R4660:Btd UTSW 14 31667803 missense probably benign 0.00
R4727:Btd UTSW 14 31662321 missense probably benign 0.01
R4923:Btd UTSW 14 31662087 missense possibly damaging 0.92
R5703:Btd UTSW 14 31667047 nonsense probably null
R5806:Btd UTSW 14 31667512 missense probably benign
R6110:Btd UTSW 14 31641108 unclassified probably benign
R6120:Btd UTSW 14 31641108 unclassified probably benign
R7019:Btd UTSW 14 31667105 missense probably damaging 1.00
R7019:Btd UTSW 14 31667106 missense possibly damaging 0.88
R7021:Btd UTSW 14 31667831 missense probably benign
R7837:Btd UTSW 14 31666827 missense possibly damaging 0.90
R7920:Btd UTSW 14 31666827 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACTAGCCTAAGAGTTGTTGTTGG -3'
(R):5'- TAGCTTGCCTCCAATCAGCG -3'

Sequencing Primer
(F):5'- TTGTTGGTGACACCCGC -3'
(R):5'- TGCCTCCAATCAGCGGGAAG -3'
Posted On2017-08-16