Incidental Mutation 'R6120:Vcam1'
ID485703
Institutional Source Beutler Lab
Gene Symbol Vcam1
Ensembl Gene ENSMUSG00000027962
Gene Namevascular cell adhesion molecule 1
SynonymsVcam-1, CD106
MMRRC Submission 044268-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R6120 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116109949-116129688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116124400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000142876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029574] [ENSMUST00000196309] [ENSMUST00000196449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029574
AA Change: V304A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029574
Gene: ENSMUSG00000027962
AA Change: V304A

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 4.5e-27 PFAM
IGc2 237 298 2.09e-15 SMART
IGc2 326 390 8.38e-6 SMART
Pfam:C2-set 421 509 7.2e-26 PFAM
IGc2 525 586 7.35e-11 SMART
IG 608 686 2.25e-6 SMART
transmembrane domain 699 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196309
SMART Domains Protein: ENSMUSP00000143260
Gene: ENSMUSG00000027962

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 38 119 1e-8 SMART
Pfam:C2-set 139 227 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196449
AA Change: V304A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142876
Gene: ENSMUSG00000027962
AA Change: V304A

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 1.3e-27 PFAM
IGc2 237 298 2.09e-15 SMART
transmembrane domain 322 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198269
Meta Mutation Damage Score 0.2229 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Most homozygous null mutants die by embryonic day 12.5 due to defective placenta and failure of chorion/allantois fusion, and heart developmental anomalies. Survivors are generally normal, but have high numbers of circulating blood mononuclear leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,638,795 V398E possibly damaging Het
Ankef1 A G 2: 136,550,376 N495S probably benign Het
Bpifb3 G T 2: 153,931,443 V428L probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ccdc178 A G 18: 22,097,728 L362S probably benign Het
Ccdc33 G A 9: 58,086,600 P88S probably damaging Het
Cdk14 A T 5: 4,894,029 D385E probably damaging Het
Chrna4 A G 2: 181,024,806 L613P probably damaging Het
Cnot3 T A 7: 3,645,336 probably null Het
Csf1 T A 3: 107,753,854 I116L probably damaging Het
Csrp2 G T 10: 110,939,279 A192S probably benign Het
Dnah9 T C 11: 66,147,399 T104A probably benign Het
Eml1 C T 12: 108,527,724 P593S probably damaging Het
Entpd2 T A 2: 25,399,466 I320N probably benign Het
Exosc9 A T 3: 36,554,672 N140I probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Fgfr2 G T 7: 130,228,690 T186K probably benign Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Gbf1 A G 19: 46,279,321 I1203V possibly damaging Het
Gja1 T A 10: 56,388,505 M320K probably benign Het
Gm5431 A G 11: 48,894,781 Y256H probably benign Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Greb1 T G 12: 16,708,621 D698A probably damaging Het
Hook2 A G 8: 84,998,125 E500G probably damaging Het
Kif13b A T 14: 64,751,558 N796I probably damaging Het
Kif1a C T 1: 93,024,574 probably null Het
Lama1 T C 17: 67,780,617 probably null Het
Mfsd1 C T 3: 67,594,385 Q246* probably null Het
Mkrn3 A G 7: 62,419,534 S170P probably benign Het
Ms4a6b A G 19: 11,521,695 M58V probably benign Het
Muc4 T C 16: 32,756,795 V2223A unknown Het
Mycbp2 A T 14: 103,275,887 V811D probably benign Het
Olfr1015 T C 2: 85,786,341 F277L probably damaging Het
Olfr483 A T 7: 108,104,133 N275Y probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcsk2 A G 2: 143,801,111 E436G probably damaging Het
Pet100 T G 8: 3,621,764 probably null Het
Pira2 A G 7: 3,841,554 Y493H probably damaging Het
Prkdc C A 16: 15,739,471 R2213S probably benign Het
Prmt2 A G 10: 76,209,446 I342T possibly damaging Het
Psmc6 A G 14: 45,348,673 E381G possibly damaging Het
Rrm1 G A 7: 102,460,856 probably null Het
Sema3c A G 5: 17,727,632 D711G probably benign Het
Sgcb T C 5: 73,640,810 E103G possibly damaging Het
Sh3pxd2a A G 19: 47,267,409 S957P probably damaging Het
Slc26a2 A G 18: 61,199,417 V314A possibly damaging Het
Smarca5 G T 8: 80,711,743 H655N probably damaging Het
Sspo T A 6: 48,465,576 S2002T probably damaging Het
Sync T C 4: 129,293,751 L192P probably damaging Het
Ush2a T C 1: 188,358,603 M477T probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn2r115 T A 17: 23,346,029 W297R probably damaging Het
Vmn2r120 T A 17: 57,525,973 M69L probably benign Het
Wdr11 A G 7: 129,624,791 D771G probably damaging Het
Other mutations in Vcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Vcam1 APN 3 116114471 missense possibly damaging 0.85
IGL01546:Vcam1 APN 3 116115942 missense possibly damaging 0.86
IGL01548:Vcam1 APN 3 116115951 missense probably benign 0.06
IGL02070:Vcam1 APN 3 116125997 missense probably benign 0.07
IGL02353:Vcam1 APN 3 116115894 missense possibly damaging 0.53
IGL02360:Vcam1 APN 3 116115894 missense possibly damaging 0.53
K7371:Vcam1 UTSW 3 116124649 missense probably benign 0.00
R0310:Vcam1 UTSW 3 116114416 missense possibly damaging 0.93
R0319:Vcam1 UTSW 3 116116060 missense probably benign 0.01
R0468:Vcam1 UTSW 3 116115946 nonsense probably null
R0638:Vcam1 UTSW 3 116117259 missense possibly damaging 0.71
R1070:Vcam1 UTSW 3 116110903 missense possibly damaging 0.96
R1728:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1784:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1956:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R1957:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R3052:Vcam1 UTSW 3 116124430 unclassified probably null
R3832:Vcam1 UTSW 3 116114491 missense possibly damaging 0.71
R4297:Vcam1 UTSW 3 116117243 missense probably benign
R4801:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4802:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4970:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5073:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5074:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5112:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5597:Vcam1 UTSW 3 116126002 missense probably damaging 0.99
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6617:Vcam1 UTSW 3 116126062 missense possibly damaging 0.48
R7232:Vcam1 UTSW 3 116125979 missense possibly damaging 0.71
R7350:Vcam1 UTSW 3 116114562 missense probably damaging 0.99
R7384:Vcam1 UTSW 3 116117228 missense possibly damaging 0.81
R7571:Vcam1 UTSW 3 116114383 nonsense probably null
R7606:Vcam1 UTSW 3 116121055 missense possibly damaging 0.91
R7742:Vcam1 UTSW 3 116116085 missense possibly damaging 0.71
Z1176:Vcam1 UTSW 3 116129341 missense not run
Predicted Primers PCR Primer
(F):5'- AATGCCAGTATCCACAGGGC -3'
(R):5'- AATGACCTGTTCCAGCGAGG -3'

Sequencing Primer
(F):5'- CCAGTATCCACAGGGCAGGAG -3'
(R):5'- TGTTCCAGCGAGGGTCTAC -3'
Posted On2017-08-16