Mutagenetix > Incidental Mutations

Incidental Mutation 'R6120:Sync'

485704

Institutional Source

Beutler Lab

Gene Symbol

Sync

Ensembl Gene

ENSMUSG00000001333

Gene Name

syncoilin

Synonyms

1110057H03Rik, SNIP4

MMRRC Submission

044268-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6120 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129287617-129308559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129293751 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 192 (L192P)

Ref Sequence

ENSEMBL: ENSMUSP00000099659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102599]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102599
AA Change: L192P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: L192P

Domain	Start	End	E-Value	Type
low complexity region	65	75	N/A	INTRINSIC
Filament	156	453	1.2e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146448

Meta Mutation Damage Score

0.8068

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	A	18: 6,638,795	V398E	possibly damaging	Het
Ankef1	A	G	2: 136,550,376	N495S	probably benign	Het
Bpifb3	G	T	2: 153,931,443	V428L	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
Ccdc178	A	G	18: 22,097,728	L362S	probably benign	Het
Ccdc33	G	A	9: 58,086,600	P88S	probably damaging	Het
Cdk14	A	T	5: 4,894,029	D385E	probably damaging	Het
Chrna4	A	G	2: 181,024,806	L613P	probably damaging	Het
Cnot3	T	A	7: 3,645,336		probably null	Het
Csf1	T	A	3: 107,753,854	I116L	probably damaging	Het
Csrp2	G	T	10: 110,939,279	A192S	probably benign	Het
Dnah9	T	C	11: 66,147,399	T104A	probably benign	Het
Eml1	C	T	12: 108,527,724	P593S	probably damaging	Het
Entpd2	T	A	2: 25,399,466	I320N	probably benign	Het
Exosc9	A	T	3: 36,554,672	N140I	probably damaging	Het
Fam186a	T	C	15: 99,940,363	T2667A	probably benign	Het
Fes	T	C	7: 80,380,867	D558G	probably damaging	Het
Fgfr2	G	T	7: 130,228,690	T186K	probably benign	Het
Fnip1	A	G	11: 54,510,000	E1075G	probably benign	Het
Gbf1	A	G	19: 46,279,321	I1203V	possibly damaging	Het
Gja1	T	A	10: 56,388,505	M320K	probably benign	Het
Gm5431	A	G	11: 48,894,781	Y256H	probably benign	Het
Gpr20	C	T	15: 73,696,004	V179M	probably damaging	Het
Greb1	T	G	12: 16,708,621	D698A	probably damaging	Het
Hook2	A	G	8: 84,998,125	E500G	probably damaging	Het
Kif13b	A	T	14: 64,751,558	N796I	probably damaging	Het
Kif1a	C	T	1: 93,024,574		probably null	Het
Lama1	T	C	17: 67,780,617		probably null	Het
Mfsd1	C	T	3: 67,594,385	Q246*	probably null	Het
Mkrn3	A	G	7: 62,419,534	S170P	probably benign	Het
Ms4a6b	A	G	19: 11,521,695	M58V	probably benign	Het
Muc4	T	C	16: 32,756,795	V2223A	unknown	Het
Mycbp2	A	T	14: 103,275,887	V811D	probably benign	Het
Olfr1015	T	C	2: 85,786,341	F277L	probably damaging	Het
Olfr483	A	T	7: 108,104,133	N275Y	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcsk2	A	G	2: 143,801,111	E436G	probably damaging	Het
Pet100	T	G	8: 3,621,764		probably null	Het
Pira2	A	G	7: 3,841,554	Y493H	probably damaging	Het
Prkdc	C	A	16: 15,739,471	R2213S	probably benign	Het
Prmt2	A	G	10: 76,209,446	I342T	possibly damaging	Het
Psmc6	A	G	14: 45,348,673	E381G	possibly damaging	Het
Rrm1	G	A	7: 102,460,856		probably null	Het
Sema3c	A	G	5: 17,727,632	D711G	probably benign	Het
Sgcb	T	C	5: 73,640,810	E103G	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,409	S957P	probably damaging	Het
Slc26a2	A	G	18: 61,199,417	V314A	possibly damaging	Het
Smarca5	G	T	8: 80,711,743	H655N	probably damaging	Het
Sspo	T	A	6: 48,465,576	S2002T	probably damaging	Het
Ush2a	T	C	1: 188,358,603	M477T	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vcam1	A	G	3: 116,124,400	V304A	probably damaging	Het
Vmn2r115	T	A	17: 23,346,029	W297R	probably damaging	Het
Vmn2r120	T	A	17: 57,525,973	M69L	probably benign	Het
Wdr11	A	G	7: 129,624,791	D771G	probably damaging	Het

Other mutations in Sync

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02629:Sync	APN	4	129293951	missense	probably damaging	0.99
PIT4354001:Sync	UTSW	4	129306654	missense	possibly damaging	0.71
R0017:Sync	UTSW	4	129293744	missense	probably damaging	1.00
R0017:Sync	UTSW	4	129293744	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0825:Sync	UTSW	4	129293397	missense	probably benign	0.04
R0846:Sync	UTSW	4	129294104	missense	probably benign	0.13
R3824:Sync	UTSW	4	129294363	missense	possibly damaging	0.95
R4151:Sync	UTSW	4	129293726	nonsense	probably null
R4166:Sync	UTSW	4	129306742	intron	probably benign
R4760:Sync	UTSW	4	129293439	missense	probably benign	0.01
R5753:Sync	UTSW	4	129293386	nonsense	probably null
R6578:Sync	UTSW	4	129294267	missense	probably damaging	1.00
R6860:Sync	UTSW	4	129287790	critical splice donor site	probably null
R7347:Sync	UTSW	4	129294306	missense	probably benign	0.22
R7612:Sync	UTSW	4	129293582	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- ATTTCAGAGCAGCCTGTGG -3'
(R):5'- ACTCCAGCTGGTATTGGTAAGC -3'

Sequencing Primer
(F):5'- TAAGAGCCCAACTGCTTGTG -3'
(R):5'- GGTATTGGTAAGCCACGCATTCC -3'

Posted On

2017-08-16