Mutagenetix > Incidental Mutation

Incidental Mutation 'R6120:Sema3c'

485706

Institutional Source

Beutler Lab

Gene Symbol

Sema3c

Ensembl Gene

ENSMUSG00000028780

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

Synonyms

1110036B02Rik, Semae

MMRRC Submission

044268-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6120 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17574281-17730268 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17727632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 711 (D711G)

Ref Sequence

ENSEMBL: ENSMUSP00000030568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030568]

AlphaFold

Q62181

Predicted Effect

probably benign
Transcript: ENSMUST00000030568
AA Change: D711G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: D711G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Sema	54	495	1.16e-200	SMART
PSI	513	565	2.87e-13	SMART
IG	577	662	7.08e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115271

Meta Mutation Damage Score

0.0694

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	A	18: 6,638,795	V398E	possibly damaging	Het
Ankef1	A	G	2: 136,550,376	N495S	probably benign	Het
Bpifb3	G	T	2: 153,931,443	V428L	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
Ccdc178	A	G	18: 22,097,728	L362S	probably benign	Het
Ccdc33	G	A	9: 58,086,600	P88S	probably damaging	Het
Cdk14	A	T	5: 4,894,029	D385E	probably damaging	Het
Chrna4	A	G	2: 181,024,806	L613P	probably damaging	Het
Cnot3	T	A	7: 3,645,336		probably null	Het
Csf1	T	A	3: 107,753,854	I116L	probably damaging	Het
Csrp2	G	T	10: 110,939,279	A192S	probably benign	Het
Dnah9	T	C	11: 66,147,399	T104A	probably benign	Het
Eml1	C	T	12: 108,527,724	P593S	probably damaging	Het
Entpd2	T	A	2: 25,399,466	I320N	probably benign	Het
Exosc9	A	T	3: 36,554,672	N140I	probably damaging	Het
Fam186a	T	C	15: 99,940,363	T2667A	probably benign	Het
Fes	T	C	7: 80,380,867	D558G	probably damaging	Het
Fgfr2	G	T	7: 130,228,690	T186K	probably benign	Het
Fnip1	A	G	11: 54,510,000	E1075G	probably benign	Het
Gbf1	A	G	19: 46,279,321	I1203V	possibly damaging	Het
Gja1	T	A	10: 56,388,505	M320K	probably benign	Het
Gm5431	A	G	11: 48,894,781	Y256H	probably benign	Het
Gpr20	C	T	15: 73,696,004	V179M	probably damaging	Het
Greb1	T	G	12: 16,708,621	D698A	probably damaging	Het
Hook2	A	G	8: 84,998,125	E500G	probably damaging	Het
Kif13b	A	T	14: 64,751,558	N796I	probably damaging	Het
Kif1a	C	T	1: 93,024,574		probably null	Het
Lama1	T	C	17: 67,780,617		probably null	Het
Mfsd1	C	T	3: 67,594,385	Q246*	probably null	Het
Mkrn3	A	G	7: 62,419,534	S170P	probably benign	Het
Ms4a6b	A	G	19: 11,521,695	M58V	probably benign	Het
Muc4	T	C	16: 32,756,795	V2223A	unknown	Het
Mycbp2	A	T	14: 103,275,887	V811D	probably benign	Het
Olfr1015	T	C	2: 85,786,341	F277L	probably damaging	Het
Olfr483	A	T	7: 108,104,133	N275Y	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcsk2	A	G	2: 143,801,111	E436G	probably damaging	Het
Pet100	T	G	8: 3,621,764		probably null	Het
Pira2	A	G	7: 3,841,554	Y493H	probably damaging	Het
Prkdc	C	A	16: 15,739,471	R2213S	probably benign	Het
Prmt2	A	G	10: 76,209,446	I342T	possibly damaging	Het
Psmc6	A	G	14: 45,348,673	E381G	possibly damaging	Het
Rrm1	G	A	7: 102,460,856		probably null	Het
Sgcb	T	C	5: 73,640,810	E103G	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,409	S957P	probably damaging	Het
Slc26a2	A	G	18: 61,199,417	V314A	possibly damaging	Het
Smarca5	G	T	8: 80,711,743	H655N	probably damaging	Het
Sspo	T	A	6: 48,465,576	S2002T	probably damaging	Het
Sync	T	C	4: 129,293,751	L192P	probably damaging	Het
Ush2a	T	C	1: 188,358,603	M477T	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vcam1	A	G	3: 116,124,400	V304A	probably damaging	Het
Vmn2r115	T	A	17: 23,346,029	W297R	probably damaging	Het
Vmn2r120	T	A	17: 57,525,973	M69L	probably benign	Het
Wdr11	A	G	7: 129,624,791	D771G	probably damaging	Het

Other mutations in Sema3c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Sema3c	APN	5	17694860	missense	probably damaging	1.00
IGL01528:Sema3c	APN	5	17714415	missense	probably benign
IGL01618:Sema3c	APN	5	17672506	missense	probably damaging	1.00
IGL01730:Sema3c	APN	5	17711436	missense	probably benign	0.01
IGL01762:Sema3c	APN	5	17694851	missense	possibly damaging	0.81
IGL02049:Sema3c	APN	5	17721925	splice site	probably benign
IGL02249:Sema3c	APN	5	17662963	missense	probably damaging	1.00
IGL02657:Sema3c	APN	5	17576868	start codon destroyed	possibly damaging	0.71
IGL02657:Sema3c	APN	5	17662974	missense	probably damaging	1.00
IGL03213:Sema3c	APN	5	17694639	splice site	probably benign
PIT4651001:Sema3c	UTSW	5	17694733	missense	probably benign	0.37
R0031:Sema3c	UTSW	5	17694728	missense	probably damaging	1.00
R0558:Sema3c	UTSW	5	17714415	missense	probably benign	0.00
R0964:Sema3c	UTSW	5	17721909	missense	probably damaging	1.00
R1164:Sema3c	UTSW	5	17678314	missense	probably benign	0.40
R1351:Sema3c	UTSW	5	17678336	missense	possibly damaging	0.60
R1368:Sema3c	UTSW	5	17678332	missense	possibly damaging	0.96
R1480:Sema3c	UTSW	5	17682031	missense	possibly damaging	0.57
R1880:Sema3c	UTSW	5	17727466	nonsense	probably null
R1916:Sema3c	UTSW	5	17727401	missense	probably benign	0.06
R3934:Sema3c	UTSW	5	17681940	missense	probably damaging	0.97
R4284:Sema3c	UTSW	5	17678347	missense	probably benign	0.01
R4449:Sema3c	UTSW	5	17576846	start gained	probably benign
R4545:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4546:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4660:Sema3c	UTSW	5	17672513	missense	probably damaging	1.00
R4890:Sema3c	UTSW	5	17675159	missense	probably benign	0.00
R4937:Sema3c	UTSW	5	17694686	missense	probably benign	0.01
R5065:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5145:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5452:Sema3c	UTSW	5	17717070	critical splice donor site	probably null
R5586:Sema3c	UTSW	5	17711424	missense	probably damaging	0.99
R5811:Sema3c	UTSW	5	17675190	splice site	probably null
R5886:Sema3c	UTSW	5	17681986	missense	possibly damaging	0.90
R6191:Sema3c	UTSW	5	17653806	missense	probably damaging	1.00
R6318:Sema3c	UTSW	5	17672432	missense	probably damaging	0.96
R6416:Sema3c	UTSW	5	17576961	missense	probably damaging	0.99
R6441:Sema3c	UTSW	5	17724132	missense	possibly damaging	0.96
R6816:Sema3c	UTSW	5	17670465	missense	probably benign	0.36
R7146:Sema3c	UTSW	5	17694703	missense	probably benign	0.22
R7526:Sema3c	UTSW	5	17727596	missense	possibly damaging	0.46
R7832:Sema3c	UTSW	5	17694847	missense	probably damaging	0.99
R8034:Sema3c	UTSW	5	17727482	missense	probably damaging	1.00
R8053:Sema3c	UTSW	5	17655022	missense	probably benign	0.00
R8076:Sema3c	UTSW	5	17727364	missense	probably benign	0.00
R8264:Sema3c	UTSW	5	17676539	intron	probably benign
R8359:Sema3c	UTSW	5	17653728	missense	possibly damaging	0.56
R8437:Sema3c	UTSW	5	17662938	missense	probably damaging	0.99
R9174:Sema3c	UTSW	5	17663041	critical splice donor site	probably null
R9295:Sema3c	UTSW	5	17727497	missense	probably benign	0.09
R9477:Sema3c	UTSW	5	17716983	missense
R9599:Sema3c	UTSW	5	17714454	critical splice donor site	probably null
R9702:Sema3c	UTSW	5	17653830	missense	probably damaging	1.00
Z1176:Sema3c	UTSW	5	17727519	missense	probably benign	0.04
Z1177:Sema3c	UTSW	5	17717031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTCTGACCAAGGACTCTACCAC -3'
(R):5'- AGACAGAGCATTTGTTCCTGG -3'

Sequencing Primer
(F):5'- TTGCCACTGAGAACAGCTTC -3'
(R):5'- GAGCATTTGTTCCTGGAAGCAAAAC -3'

Posted On

2017-08-16