Mutagenetix > Incidental Mutation

Incidental Mutation 'R6120:Sspo'

485708

Institutional Source

Beutler Lab

Gene Symbol

Sspo

Ensembl Gene

ENSMUSG00000029797

Gene Name

SCO-spondin

Synonyms

Scospondin, C79529

MMRRC Submission

044268-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6120 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48448229-48501250 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48465576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2002 (S2002T)

Ref Sequence

ENSEMBL: ENSMUSP00000131401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043676
AA Change: S1861T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: S1861T

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
Pfam:VWD	154	219	7.4e-11	PFAM
C8	267	346	2.3e-10	SMART
Pfam:TIL	349	404	3.2e-13	PFAM
VWC	406	448	2e-1	SMART
VWD	433	593	5.08e-29	SMART
C8	631	703	2.14e-28	SMART
Pfam:TIL	706	759	5.8e-11	PFAM
VWC	856	924	4.76e-2	SMART
VWD	883	1042	9.59e-48	SMART
C8	1076	1150	3.62e-26	SMART
Pfam:TIL	1153	1209	2.6e-13	PFAM
LDLa	1253	1291	2.29e-13	SMART
LDLa	1293	1328	1.87e-9	SMART
LDLa	1329	1366	5.77e-10	SMART
LDLa	1369	1408	1.52e-9	SMART
LDLa	1442	1479	2.55e-11	SMART
LDLa	1480	1520	5.6e-8	SMART
LDLa	1533	1574	2.29e-4	SMART
TSP1	1575	1626	6.47e-13	SMART
TSP1	1631	1686	1.35e-10	SMART
Pfam:TIL	1690	1746	3.1e-9	PFAM
TSP1	1774	1827	6.94e-2	SMART
VWC	1829	1886	4.95e-9	SMART
low complexity region	1901	1911	N/A	INTRINSIC
FA58C	1928	2085	1.4e-2	SMART
LDLa	2091	2128	1.48e-7	SMART
LDLa	2242	2279	5.68e-9	SMART
LDLa	2299	2336	5.77e-10	SMART
TSP1	2339	2389	1.42e-9	SMART
TSP1	2394	2446	6.36e-21	SMART
Pfam:TIL	2460	2511	5.7e-10	PFAM
VWC	2513	2567	2.48e-1	SMART
TSP1	2554	2605	3.07e-14	SMART
TSP1	2611	2664	4.05e-5	SMART
TSP1	2669	2719	1.83e-12	SMART
EGF_like	2733	2776	5.45e1	SMART
VWC	2783	2836	2.73e-11	SMART
TSP1	2823	2875	3.72e-13	SMART
TSP1	2878	2919	6.05e-4	SMART
Pfam:TIL	2926	2978	1.1e-11	PFAM
VWC	2980	3035	9.77e-2	SMART
TSP1	3022	3086	6.68e-6	SMART
TSP1	3091	3143	1.08e-14	SMART
Pfam:TIL	3147	3201	2.2e-9	PFAM
VWC	3203	3260	2.72e-1	SMART
TSP1	3247	3306	3.72e-4	SMART
TSP1	3311	3363	5.27e-4	SMART
Pfam:TIL	3365	3421	4.2e-9	PFAM
TSP1	3484	3529	1.87e-9	SMART
low complexity region	3591	3601	N/A	INTRINSIC
TSP1	3660	3713	5.02e-10	SMART
TSP1	3730	3779	2.95e-7	SMART
TSP1	3796	3849	1.99e-13	SMART
TSP1	3854	3906	2.51e-10	SMART
Pfam:TIL	3909	3964	3.4e-11	PFAM
VWC	3966	4022	1.26e0	SMART
TSP1	4009	4059	4.05e-5	SMART
TSP1	4103	4155	3.19e-12	SMART
TSP1	4161	4213	2.87e-2	SMART
TSP1	4218	4269	1.45e-6	SMART
Pfam:TIL	4273	4328	2.1e-10	PFAM
TSP1	4468	4516	7.56e-5	SMART
low complexity region	4551	4562	N/A	INTRINSIC
VWC	4578	4652	5.21e-1	SMART
TSP1	4619	4669	3.92e-12	SMART
Pfam:TIL	4671	4725	1.5e-11	PFAM
Pfam:TIL	4777	4835	3.1e-9	PFAM
VWC	4837	4892	1.8e-11	SMART
GHB	4904	4997	1.02e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169350
AA Change: S2002T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: S2002T

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
VWD	185	341	4.36e-28	SMART
C8	390	469	2.3e-10	SMART
Pfam:TIL	472	527	8.6e-13	PFAM
VWC	529	571	2e-1	SMART
VWD	556	716	5.08e-29	SMART
C8	754	826	2.14e-28	SMART
Pfam:TIL	829	882	1.6e-10	PFAM
VWC	979	1047	4.76e-2	SMART
VWD	1006	1165	9.59e-48	SMART
C8	1201	1275	3.62e-26	SMART
Pfam:TIL	1278	1334	7e-13	PFAM
LDLa	1378	1416	2.29e-13	SMART
LDLa	1418	1453	1.87e-9	SMART
LDLa	1454	1491	5.77e-10	SMART
LDLa	1494	1533	1.52e-9	SMART
LDLa	1567	1604	2.55e-11	SMART
LDLa	1605	1645	5.6e-8	SMART
LDLa	1658	1699	2.29e-4	SMART
TSP1	1700	1751	6.47e-13	SMART
TSP1	1756	1811	1.35e-10	SMART
Pfam:TIL	1815	1871	8.3e-9	PFAM
VWC	1873	1928	2.42e-1	SMART
TSP1	1915	1968	6.94e-2	SMART
VWC	1970	2027	4.95e-9	SMART
low complexity region	2042	2052	N/A	INTRINSIC
FA58C	2069	2226	1.4e-2	SMART
LDLa	2232	2269	1.48e-7	SMART
LDLa	2387	2424	5.68e-9	SMART
LDLa	2444	2481	5.77e-10	SMART
TSP1	2484	2534	1.42e-9	SMART
TSP1	2539	2591	6.36e-21	SMART
Pfam:TIL	2606	2656	1.8e-9	PFAM
VWC	2658	2712	2.48e-1	SMART
TSP1	2699	2750	3.07e-14	SMART
TSP1	2756	2809	4.05e-5	SMART
TSP1	2814	2864	1.83e-12	SMART
EGF_like	2878	2921	5.45e1	SMART
VWC	2928	2981	2.73e-11	SMART
TSP1	2968	3020	3.72e-13	SMART
TSP1	3023	3064	6.05e-4	SMART
Pfam:TIL	3071	3123	3e-11	PFAM
VWC	3125	3180	9.77e-2	SMART
TSP1	3167	3231	6.68e-6	SMART
TSP1	3236	3288	1.08e-14	SMART
Pfam:TIL	3292	3346	6e-9	PFAM
VWC	3348	3405	2.72e-1	SMART
TSP1	3392	3451	3.72e-4	SMART
TSP1	3456	3508	5.27e-4	SMART
Pfam:TIL	3510	3566	1.1e-8	PFAM
TSP1	3629	3674	1.87e-9	SMART
low complexity region	3734	3744	N/A	INTRINSIC
TSP1	3803	3856	5.02e-10	SMART
TSP1	3873	3922	2.95e-7	SMART
TSP1	3939	3992	1.99e-13	SMART
TSP1	3997	4049	2.51e-10	SMART
Pfam:TIL	4052	4107	9.1e-11	PFAM
VWC	4109	4165	1.26e0	SMART
TSP1	4152	4202	4.05e-5	SMART
TSP1	4246	4298	3.19e-12	SMART
TSP1	4304	4356	2.87e-2	SMART
TSP1	4361	4412	1.45e-6	SMART
Pfam:TIL	4416	4471	5.6e-10	PFAM
TSP1	4611	4659	7.56e-5	SMART
low complexity region	4694	4705	N/A	INTRINSIC
VWC	4721	4795	5.21e-1	SMART
TSP1	4762	4812	3.92e-12	SMART
Pfam:TIL	4814	4868	4e-11	PFAM
Pfam:TIL	4920	4978	8.4e-9	PFAM
VWC	4980	5035	1.8e-11	SMART
GHB	5050	5143	1.02e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212740
AA Change: S2002T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.1730

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.6%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	A	18: 6,638,795	V398E	possibly damaging	Het
Ankef1	A	G	2: 136,550,376	N495S	probably benign	Het
Bpifb3	G	T	2: 153,931,443	V428L	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
Ccdc178	A	G	18: 22,097,728	L362S	probably benign	Het
Ccdc33	G	A	9: 58,086,600	P88S	probably damaging	Het
Cdk14	A	T	5: 4,894,029	D385E	probably damaging	Het
Chrna4	A	G	2: 181,024,806	L613P	probably damaging	Het
Cnot3	T	A	7: 3,645,336		probably null	Het
Csf1	T	A	3: 107,753,854	I116L	probably damaging	Het
Csrp2	G	T	10: 110,939,279	A192S	probably benign	Het
Dnah9	T	C	11: 66,147,399	T104A	probably benign	Het
Eml1	C	T	12: 108,527,724	P593S	probably damaging	Het
Entpd2	T	A	2: 25,399,466	I320N	probably benign	Het
Exosc9	A	T	3: 36,554,672	N140I	probably damaging	Het
Fam186a	T	C	15: 99,940,363	T2667A	probably benign	Het
Fes	T	C	7: 80,380,867	D558G	probably damaging	Het
Fgfr2	G	T	7: 130,228,690	T186K	probably benign	Het
Fnip1	A	G	11: 54,510,000	E1075G	probably benign	Het
Gbf1	A	G	19: 46,279,321	I1203V	possibly damaging	Het
Gja1	T	A	10: 56,388,505	M320K	probably benign	Het
Gm5431	A	G	11: 48,894,781	Y256H	probably benign	Het
Gpr20	C	T	15: 73,696,004	V179M	probably damaging	Het
Greb1	T	G	12: 16,708,621	D698A	probably damaging	Het
Hook2	A	G	8: 84,998,125	E500G	probably damaging	Het
Kif13b	A	T	14: 64,751,558	N796I	probably damaging	Het
Kif1a	C	T	1: 93,024,574		probably null	Het
Lama1	T	C	17: 67,780,617		probably null	Het
Mfsd1	C	T	3: 67,594,385	Q246*	probably null	Het
Mkrn3	A	G	7: 62,419,534	S170P	probably benign	Het
Ms4a6b	A	G	19: 11,521,695	M58V	probably benign	Het
Muc4	T	C	16: 32,756,795	V2223A	unknown	Het
Mycbp2	A	T	14: 103,275,887	V811D	probably benign	Het
Olfr1015	T	C	2: 85,786,341	F277L	probably damaging	Het
Olfr483	A	T	7: 108,104,133	N275Y	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcsk2	A	G	2: 143,801,111	E436G	probably damaging	Het
Pet100	T	G	8: 3,621,764		probably null	Het
Pira2	A	G	7: 3,841,554	Y493H	probably damaging	Het
Prkdc	C	A	16: 15,739,471	R2213S	probably benign	Het
Prmt2	A	G	10: 76,209,446	I342T	possibly damaging	Het
Psmc6	A	G	14: 45,348,673	E381G	possibly damaging	Het
Rrm1	G	A	7: 102,460,856		probably null	Het
Sema3c	A	G	5: 17,727,632	D711G	probably benign	Het
Sgcb	T	C	5: 73,640,810	E103G	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,409	S957P	probably damaging	Het
Slc26a2	A	G	18: 61,199,417	V314A	possibly damaging	Het
Smarca5	G	T	8: 80,711,743	H655N	probably damaging	Het
Sync	T	C	4: 129,293,751	L192P	probably damaging	Het
Ush2a	T	C	1: 188,358,603	M477T	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vcam1	A	G	3: 116,124,400	V304A	probably damaging	Het
Vmn2r115	T	A	17: 23,346,029	W297R	probably damaging	Het
Vmn2r120	T	A	17: 57,525,973	M69L	probably benign	Het
Wdr11	A	G	7: 129,624,791	D771G	probably damaging	Het

Other mutations in Sspo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Sspo	APN	6	48470453	missense	probably benign	0.02
IGL00339:Sspo	APN	6	48483746	splice site	probably benign
IGL00391:Sspo	APN	6	48497386	missense	probably damaging	0.96
IGL00433:Sspo	APN	6	48490036	missense	probably damaging	1.00
IGL00471:Sspo	APN	6	48498213	splice site	probably benign
IGL00500:Sspo	APN	6	48497421	nonsense	probably null
IGL00537:Sspo	APN	6	48498213	splice site	probably benign
IGL00540:Sspo	APN	6	48498213	splice site	probably benign
IGL01060:Sspo	APN	6	48449479	nonsense	probably null
IGL01090:Sspo	APN	6	48490125	missense	probably benign	0.08
IGL01125:Sspo	APN	6	48492888	missense	probably damaging	1.00
IGL01447:Sspo	APN	6	48464666	splice site	probably null
IGL01457:Sspo	APN	6	48498343	missense	probably benign	0.00
IGL01481:Sspo	APN	6	48448515	missense	probably benign	0.41
IGL01485:Sspo	APN	6	48478731	missense	probably damaging	1.00
IGL01544:Sspo	APN	6	48491019	missense	probably damaging	0.99
IGL01575:Sspo	APN	6	48459042	missense	probably benign	0.01
IGL01589:Sspo	APN	6	48451178	missense	probably damaging	1.00
IGL01601:Sspo	APN	6	48486379	missense	probably benign	0.33
IGL01644:Sspo	APN	6	48452502	missense	probably benign
IGL01659:Sspo	APN	6	48474443	missense	probably damaging	1.00
IGL01801:Sspo	APN	6	48457138	missense	probably damaging	1.00
IGL01872:Sspo	APN	6	48454689	missense	probably damaging	0.99
IGL01874:Sspo	APN	6	48452190	missense	probably damaging	1.00
IGL01936:Sspo	APN	6	48475887	missense	probably damaging	1.00
IGL01941:Sspo	APN	6	48495182	missense	probably benign	0.19
IGL01986:Sspo	APN	6	48483303	missense	probably benign	0.05
IGL01987:Sspo	APN	6	48477624	splice site	probably null
IGL02170:Sspo	APN	6	48467983	missense	possibly damaging	0.76
IGL02192:Sspo	APN	6	48459568	missense	possibly damaging	0.86
IGL02210:Sspo	APN	6	48500492	missense	probably damaging	1.00
IGL02225:Sspo	APN	6	48484334	missense	probably benign	0.09
IGL02280:Sspo	APN	6	48496231	missense	probably damaging	1.00
IGL02303:Sspo	APN	6	48484705	missense	possibly damaging	0.52
IGL02397:Sspo	APN	6	48461638	missense	probably benign	0.35
IGL02451:Sspo	APN	6	48460303	splice site	probably benign
IGL02500:Sspo	APN	6	48478379	nonsense	probably null
IGL02519:Sspo	APN	6	48484828	missense	probably damaging	1.00
IGL02549:Sspo	APN	6	48451773	missense	possibly damaging	0.81
IGL02562:Sspo	APN	6	48490122	splice site	probably null
IGL02673:Sspo	APN	6	48475860	missense	probably damaging	1.00
IGL02673:Sspo	APN	6	48498775	critical splice donor site	probably null
IGL02719:Sspo	APN	6	48482667	missense	probably benign	0.39
IGL02793:Sspo	APN	6	48487894	splice site	probably benign
IGL03003:Sspo	APN	6	48455087	missense	probably damaging	0.98
IGL03056:Sspo	APN	6	48470538	missense	probably benign	0.17
IGL03105:Sspo	APN	6	48473658	splice site	probably benign
IGL03116:Sspo	APN	6	48494101	missense	probably benign	0.32
IGL03163:Sspo	APN	6	48484332	missense	probably benign	0.19
IGL03198:Sspo	APN	6	48477582	missense	probably benign	0.31
IGL03365:Sspo	APN	6	48459415	missense	possibly damaging	0.82
Barrier	UTSW	6	48495212	missense	possibly damaging	0.58
R0312_sspo_280	UTSW	6	48455401	missense	possibly damaging	0.52
R3112_Sspo_731	UTSW	6	48457600	missense	probably damaging	1.00
R3498_Sspo_650	UTSW	6	48467980	missense	possibly damaging	0.58
R4180_Sspo_324	UTSW	6	48498395	critical splice donor site	probably null
spotsylvania	UTSW	6	48476571	nonsense	probably null
ANU74:Sspo	UTSW	6	48460959	missense	probably damaging	1.00
IGL02984:Sspo	UTSW	6	48495155	missense	probably benign	0.33
IGL03052:Sspo	UTSW	6	48460453	missense	probably damaging	1.00
IGL03134:Sspo	UTSW	6	48451065	missense	probably benign	0.28
PIT4531001:Sspo	UTSW	6	48481239	missense	probably benign
R0087:Sspo	UTSW	6	48477785	missense	probably damaging	1.00
R0122:Sspo	UTSW	6	48473976	missense	possibly damaging	0.95
R0129:Sspo	UTSW	6	48455418	missense	probably benign	0.00
R0164:Sspo	UTSW	6	48494194	splice site	probably benign
R0195:Sspo	UTSW	6	48486636	missense	probably benign
R0200:Sspo	UTSW	6	48486415	missense	probably null	0.01
R0201:Sspo	UTSW	6	48455752	missense	possibly damaging	0.64
R0241:Sspo	UTSW	6	48461495	missense	possibly damaging	0.82
R0241:Sspo	UTSW	6	48461495	missense	possibly damaging	0.82
R0243:Sspo	UTSW	6	48493186	missense	probably damaging	1.00
R0268:Sspo	UTSW	6	48465555	missense	probably benign	0.26
R0312:Sspo	UTSW	6	48455401	missense	possibly damaging	0.52
R0449:Sspo	UTSW	6	48466740	missense	probably damaging	1.00
R0523:Sspo	UTSW	6	48451860	missense	probably benign	0.20
R0576:Sspo	UTSW	6	48464942	splice site	probably null
R0671:Sspo	UTSW	6	48490391	splice site	probably benign
R0828:Sspo	UTSW	6	48498734	missense	probably damaging	1.00
R0880:Sspo	UTSW	6	48475935	missense	possibly damaging	0.69
R0903:Sspo	UTSW	6	48455308	critical splice acceptor site	probably null
R1051:Sspo	UTSW	6	48491455	nonsense	probably null
R1083:Sspo	UTSW	6	48470999	missense	possibly damaging	0.91
R1109:Sspo	UTSW	6	48497443	missense	probably damaging	1.00
R1118:Sspo	UTSW	6	48459418	missense	probably damaging	0.97
R1256:Sspo	UTSW	6	48457639	missense	probably damaging	1.00
R1342:Sspo	UTSW	6	48461635	missense	probably benign	0.07
R1355:Sspo	UTSW	6	48448626	missense	probably benign	0.41
R1370:Sspo	UTSW	6	48448626	missense	probably benign	0.41
R1469:Sspo	UTSW	6	48490982	missense	probably damaging	1.00
R1469:Sspo	UTSW	6	48490982	missense	probably damaging	1.00
R1476:Sspo	UTSW	6	48463400	critical splice donor site	probably null
R1566:Sspo	UTSW	6	48466870	critical splice donor site	probably null
R1630:Sspo	UTSW	6	48457724	missense	probably benign	0.01
R1686:Sspo	UTSW	6	48460400	missense	probably benign	0.00
R1707:Sspo	UTSW	6	48477877	missense	probably damaging	0.99
R1727:Sspo	UTSW	6	48494848	missense	probably damaging	1.00
R1822:Sspo	UTSW	6	48492886	missense	possibly damaging	0.75
R1831:Sspo	UTSW	6	48489786	missense	probably damaging	1.00
R1835:Sspo	UTSW	6	48457340	missense	probably damaging	0.97
R1862:Sspo	UTSW	6	48491006	missense	probably damaging	0.98
R1878:Sspo	UTSW	6	48459366	missense	possibly damaging	0.92
R1900:Sspo	UTSW	6	48459350	missense	probably benign	0.22
R1945:Sspo	UTSW	6	48489773	missense	possibly damaging	0.93
R1957:Sspo	UTSW	6	48478273	missense	probably damaging	0.99
R1990:Sspo	UTSW	6	48451050	missense	probably benign	0.00
R1996:Sspo	UTSW	6	48475490	missense	possibly damaging	0.50
R2049:Sspo	UTSW	6	48460763	splice site	probably benign
R2049:Sspo	UTSW	6	48463531	missense	probably benign	0.36
R2064:Sspo	UTSW	6	48473662	missense	probably damaging	0.99
R2072:Sspo	UTSW	6	48473517	missense	probably benign	0.01
R2096:Sspo	UTSW	6	48461674	missense	probably benign
R2106:Sspo	UTSW	6	48466316	missense	possibly damaging	0.96
R2230:Sspo	UTSW	6	48448672	missense	probably damaging	0.97
R2230:Sspo	UTSW	6	48500503	missense	probably benign	0.11
R2232:Sspo	UTSW	6	48448672	missense	probably damaging	0.97
R2351:Sspo	UTSW	6	48464869	missense	probably damaging	1.00
R2423:Sspo	UTSW	6	48454055	missense	probably benign	0.00
R2508:Sspo	UTSW	6	48464364	missense	probably damaging	1.00
R3110:Sspo	UTSW	6	48457600	missense	probably damaging	1.00
R3112:Sspo	UTSW	6	48457600	missense	probably damaging	1.00
R3413:Sspo	UTSW	6	48480697	missense	probably damaging	1.00
R3433:Sspo	UTSW	6	48475951	splice site	probably null
R3498:Sspo	UTSW	6	48467980	missense	possibly damaging	0.58
R3732:Sspo	UTSW	6	48449930	missense	probably damaging	1.00
R3816:Sspo	UTSW	6	48481103	missense	possibly damaging	0.77
R3818:Sspo	UTSW	6	48481103	missense	possibly damaging	0.77
R3819:Sspo	UTSW	6	48481103	missense	possibly damaging	0.77
R3838:Sspo	UTSW	6	48480820	missense	probably damaging	1.00
R3850:Sspo	UTSW	6	48492490	missense	probably damaging	1.00
R3880:Sspo	UTSW	6	48494940	missense	probably benign	0.38
R3893:Sspo	UTSW	6	48476571	nonsense	probably null
R4116:Sspo	UTSW	6	48456994	missense	probably damaging	0.99
R4179:Sspo	UTSW	6	48498395	critical splice donor site	probably null
R4180:Sspo	UTSW	6	48498395	critical splice donor site	probably null
R4207:Sspo	UTSW	6	48478293	missense	probably benign	0.00
R4210:Sspo	UTSW	6	48464901	missense	probably benign	0.00
R4223:Sspo	UTSW	6	48451157	missense	possibly damaging	0.54
R4224:Sspo	UTSW	6	48451157	missense	possibly damaging	0.54
R4225:Sspo	UTSW	6	48451157	missense	possibly damaging	0.54
R4229:Sspo	UTSW	6	48490934	missense	probably benign	0.00
R4230:Sspo	UTSW	6	48490934	missense	probably benign	0.00
R4363:Sspo	UTSW	6	48498731	missense	probably damaging	1.00
R4370:Sspo	UTSW	6	48466348	missense	probably null	0.14
R4407:Sspo	UTSW	6	48460520	missense	probably damaging	1.00
R4438:Sspo	UTSW	6	48487353	missense	probably damaging	1.00
R4454:Sspo	UTSW	6	48487225	missense	probably benign	0.05
R4455:Sspo	UTSW	6	48465516	missense	probably damaging	1.00
R4561:Sspo	UTSW	6	48475534	splice site	probably null
R4574:Sspo	UTSW	6	48465523	missense	probably damaging	1.00
R4578:Sspo	UTSW	6	48463373	missense	possibly damaging	0.58
R4653:Sspo	UTSW	6	48478646	missense	probably damaging	1.00
R4656:Sspo	UTSW	6	48454076	missense	possibly damaging	0.65
R4659:Sspo	UTSW	6	48484213	missense	probably damaging	1.00
R4664:Sspo	UTSW	6	48473534	missense	possibly damaging	0.82
R4685:Sspo	UTSW	6	48492894	missense	probably damaging	0.98
R4692:Sspo	UTSW	6	48482687	missense	probably damaging	1.00
R4703:Sspo	UTSW	6	48500453	missense	probably damaging	1.00
R4704:Sspo	UTSW	6	48498704	missense	probably damaging	1.00
R4738:Sspo	UTSW	6	48478396	missense	possibly damaging	0.78
R4766:Sspo	UTSW	6	48470580	missense	probably benign	0.04
R4771:Sspo	UTSW	6	48460879	missense	probably damaging	1.00
R4790:Sspo	UTSW	6	48460771	missense	probably benign	0.04
R4792:Sspo	UTSW	6	48461585	missense	probably benign	0.00
R4808:Sspo	UTSW	6	48451161	missense	probably damaging	1.00
R4812:Sspo	UTSW	6	48490510	missense	probably benign	0.00
R4883:Sspo	UTSW	6	48460822	missense	probably benign	0.00
R4906:Sspo	UTSW	6	48465730	critical splice acceptor site	probably null
R4934:Sspo	UTSW	6	48465552	missense	probably damaging	1.00
R4945:Sspo	UTSW	6	48467087	splice site	probably null
R4967:Sspo	UTSW	6	48464605	missense	probably damaging	0.97
R5016:Sspo	UTSW	6	48452280	nonsense	probably null
R5018:Sspo	UTSW	6	48455700	missense	probably damaging	1.00
R5034:Sspo	UTSW	6	48480823	missense	possibly damaging	0.93
R5044:Sspo	UTSW	6	48466955	critical splice acceptor site	probably null
R5055:Sspo	UTSW	6	48464795	missense	probably damaging	1.00
R5087:Sspo	UTSW	6	48488471	missense	possibly damaging	0.51
R5155:Sspo	UTSW	6	48460474	missense	probably benign	0.03
R5223:Sspo	UTSW	6	48478324	missense	probably damaging	1.00
R5249:Sspo	UTSW	6	48493310	missense	probably damaging	0.98
R5257:Sspo	UTSW	6	48476494	missense	probably damaging	1.00
R5258:Sspo	UTSW	6	48476494	missense	probably damaging	1.00
R5276:Sspo	UTSW	6	48490467	missense	probably damaging	1.00
R5307:Sspo	UTSW	6	48454850	missense	probably damaging	0.99
R5341:Sspo	UTSW	6	48459615	missense	probably damaging	1.00
R5361:Sspo	UTSW	6	48466313	missense	probably benign	0.02
R5385:Sspo	UTSW	6	48462253	missense	probably benign	0.18
R5394:Sspo	UTSW	6	48495260	missense	possibly damaging	0.52
R5477:Sspo	UTSW	6	48498393	missense	possibly damaging	0.60
R5490:Sspo	UTSW	6	48493280	missense	probably benign	0.33
R5512:Sspo	UTSW	6	48455671	missense	probably damaging	0.97
R5518:Sspo	UTSW	6	48496654	missense	possibly damaging	0.92
R5530:Sspo	UTSW	6	48465583	missense	probably damaging	0.97
R5538:Sspo	UTSW	6	48452178	missense	probably damaging	0.99
R5590:Sspo	UTSW	6	48474491	missense	probably damaging	1.00
R5613:Sspo	UTSW	6	48455044	missense	possibly damaging	0.79
R5638:Sspo	UTSW	6	48492891	missense	possibly damaging	0.86
R5809:Sspo	UTSW	6	48460045	missense	possibly damaging	0.59
R5810:Sspo	UTSW	6	48483898	missense	probably benign	0.02
R5814:Sspo	UTSW	6	48451884	missense	probably damaging	1.00
R5915:Sspo	UTSW	6	48464596	missense	probably benign	0.00
R5915:Sspo	UTSW	6	48491484	missense	possibly damaging	0.83
R5979:Sspo	UTSW	6	48463693	missense	probably benign	0.20
R5996:Sspo	UTSW	6	48494176	missense	possibly damaging	0.87
R6012:Sspo	UTSW	6	48451371	missense	probably benign	0.00
R6025:Sspo	UTSW	6	48486786	missense	possibly damaging	0.83
R6150:Sspo	UTSW	6	48486379	missense	probably benign	0.33
R6221:Sspo	UTSW	6	48463705	missense	probably damaging	1.00
R6261:Sspo	UTSW	6	48462191	missense	possibly damaging	0.75
R6312:Sspo	UTSW	6	48457366	critical splice donor site	probably null
R6372:Sspo	UTSW	6	48472541	missense	probably damaging	1.00
R6456:Sspo	UTSW	6	48451806	missense	probably benign	0.08
R6497:Sspo	UTSW	6	48495208	missense	possibly damaging	0.71
R6501:Sspo	UTSW	6	48495212	missense	possibly damaging	0.58
R6617:Sspo	UTSW	6	48491046	missense	possibly damaging	0.93
R6825:Sspo	UTSW	6	48465525	missense	probably benign	0.04
R6831:Sspo	UTSW	6	48484833	missense	possibly damaging	0.68
R6861:Sspo	UTSW	6	48487955	missense	probably benign	0.15
R6961:Sspo	UTSW	6	48463877	missense	probably benign	0.05
R6967:Sspo	UTSW	6	48489794	missense	probably benign	0.21
R7016:Sspo	UTSW	6	48449164	missense	probably damaging	1.00
R7035:Sspo	UTSW	6	48449213	splice site	probably null
R7058:Sspo	UTSW	6	48448582	missense	probably damaging	1.00
R7072:Sspo	UTSW	6	48454979	missense	probably damaging	1.00
R7078:Sspo	UTSW	6	48460379	missense	probably damaging	1.00
R7082:Sspo	UTSW	6	48478609	critical splice acceptor site	probably null
R7120:Sspo	UTSW	6	48465571	missense	probably benign	0.05
R7127:Sspo	UTSW	6	48449512	missense	probably benign	0.02
R7146:Sspo	UTSW	6	48501095	missense	probably benign	0.15
R7220:Sspo	UTSW	6	48476606	nonsense	probably null
R7242:Sspo	UTSW	6	48473952	missense	probably benign
R7261:Sspo	UTSW	6	48450077	missense	possibly damaging	0.52
R7313:Sspo	UTSW	6	48454828	missense	probably damaging	1.00
R7313:Sspo	UTSW	6	48473456	missense	probably benign	0.04
R7323:Sspo	UTSW	6	48461647	missense	possibly damaging	0.93
R7330:Sspo	UTSW	6	48475462	missense	probably benign	0.00
R7351:Sspo	UTSW	6	48464921	missense	possibly damaging	0.89
R7467:Sspo	UTSW	6	48486303	missense	probably damaging	1.00
R7475:Sspo	UTSW	6	48455860	missense	probably benign	0.37
R7489:Sspo	UTSW	6	48473713	missense	probably damaging	0.99
R7508:Sspo	UTSW	6	48466699	missense	probably damaging	1.00
R7515:Sspo	UTSW	6	48493886	missense	probably damaging	1.00
R7564:Sspo	UTSW	6	48449500	missense	probably benign	0.04
R7607:Sspo	UTSW	6	48489727	missense	probably damaging	1.00
R7620:Sspo	UTSW	6	48467086	critical splice donor site	probably null
R7667:Sspo	UTSW	6	48475371	nonsense	probably null
R7691:Sspo	UTSW	6	48484229	missense	probably benign	0.12
R7707:Sspo	UTSW	6	48461527	missense	probably benign	0.01
R7723:Sspo	UTSW	6	48464638	missense	probably damaging	0.99
R7748:Sspo	UTSW	6	48449465	nonsense	probably null
R7767:Sspo	UTSW	6	48451382	missense	probably damaging	0.96
R7792:Sspo	UTSW	6	48454690	missense	probably damaging	0.98
R7878:Sspo	UTSW	6	48492526	missense	probably damaging	1.00
R7893:Sspo	UTSW	6	48463310	missense	probably benign	0.02
R7942:Sspo	UTSW	6	48488500	splice site	probably null
R7952:Sspo	UTSW	6	48487329	missense	probably damaging	1.00
R7981:Sspo	UTSW	6	48468494	missense	probably benign
R7995:Sspo	UTSW	6	48492889	missense	probably damaging	1.00
R8088:Sspo	UTSW	6	48457613	missense	probably damaging	1.00
R8129:Sspo	UTSW	6	48467025	missense	possibly damaging	0.79
R8145:Sspo	UTSW	6	48467749	missense	possibly damaging	0.49
R8202:Sspo	UTSW	6	48457600	missense	probably damaging	1.00
R8211:Sspo	UTSW	6	48492609	critical splice donor site	probably null
R8240:Sspo	UTSW	6	48483502	missense	possibly damaging	0.84
R8252:Sspo	UTSW	6	48485452	missense	probably damaging	0.99
R8270:Sspo	UTSW	6	48449963	missense	probably benign
R8272:Sspo	UTSW	6	48448519	missense	probably benign	0.03
R8316:Sspo	UTSW	6	48482688	missense	probably damaging	1.00
R8384:Sspo	UTSW	6	48482664	missense	probably damaging	1.00
R8390:Sspo	UTSW	6	48467962	missense	probably benign	0.00
R8770:Sspo	UTSW	6	48474272	missense	probably null	1.00
R8827:Sspo	UTSW	6	48457672	missense	possibly damaging	0.59
R8882:Sspo	UTSW	6	48475456	missense	probably damaging	1.00
R8886:Sspo	UTSW	6	48481267	missense	possibly damaging	0.92
R8946:Sspo	UTSW	6	48457137	missense	probably damaging	1.00
R8947:Sspo	UTSW	6	48448570	missense	probably damaging	1.00
R9028:Sspo	UTSW	6	48496153	missense	probably benign	0.38
R9043:Sspo	UTSW	6	48493280	missense	probably benign	0.07
R9056:Sspo	UTSW	6	48473674	missense	probably damaging	0.97
R9071:Sspo	UTSW	6	48457048	missense	probably benign	0.00
R9133:Sspo	UTSW	6	48457813	missense	possibly damaging	0.81
R9187:Sspo	UTSW	6	48495289	missense	probably damaging	1.00
R9205:Sspo	UTSW	6	48455872	missense	probably benign	0.03
R9213:Sspo	UTSW	6	48463935	missense	possibly damaging	0.91
R9214:Sspo	UTSW	6	48463935	missense	possibly damaging	0.91
R9215:Sspo	UTSW	6	48463935	missense	possibly damaging	0.91
R9235:Sspo	UTSW	6	48489784	missense	probably damaging	1.00
R9254:Sspo	UTSW	6	48487994	missense	probably damaging	1.00
R9291:Sspo	UTSW	6	48496396	missense	probably damaging	1.00
R9312:Sspo	UTSW	6	48468462	missense	probably benign	0.00
R9357:Sspo	UTSW	6	48467055	missense	possibly damaging	0.77
R9480:Sspo	UTSW	6	48493886	missense	probably damaging	1.00
R9586:Sspo	UTSW	6	48481105	missense	probably benign	0.03
R9660:Sspo	UTSW	6	48455773	missense	probably damaging	1.00
R9661:Sspo	UTSW	6	48478338	nonsense	probably null
R9728:Sspo	UTSW	6	48455773	missense	probably damaging	1.00
R9776:Sspo	UTSW	6	48462335	missense	probably benign	0.00
RF009:Sspo	UTSW	6	48459985	nonsense	probably null
X0060:Sspo	UTSW	6	48466294	missense	probably damaging	1.00
X0060:Sspo	UTSW	6	48480794	missense	probably damaging	1.00
X0063:Sspo	UTSW	6	48497422	missense	probably damaging	0.96
X0065:Sspo	UTSW	6	48461684	missense	probably benign	0.00
Z1176:Sspo	UTSW	6	48481293	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48457026	missense	probably benign	0.31
Z1177:Sspo	UTSW	6	48464816	missense	possibly damaging	0.72
Z1177:Sspo	UTSW	6	48470984	missense	probably benign	0.16
Z1177:Sspo	UTSW	6	48473435	missense	probably damaging	0.99
Z1177:Sspo	UTSW	6	48490548	nonsense	probably null
Z1177:Sspo	UTSW	6	48490890	missense	probably damaging	1.00
Z1186:Sspo	UTSW	6	48468507	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATGCCCTTTGTCCACCAAG -3'
(R):5'- GGCAACATGATTCTCCCATCC -3'

Sequencing Primer
(F):5'- TTTGTCCACCAAGCAGGG -3'
(R):5'- TCCCTTCCACCAGGACC -3'

Posted On

2017-08-16