Incidental Mutation 'R6120:Rrm1'
ID485713
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Nameribonucleotide reductase M1
SynonymsRnrM1
MMRRC Submission 044268-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6120 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102441695-102469771 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 102460856 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000033283] [ENSMUST00000209630]
Predicted Effect probably null
Transcript: ENSMUST00000033283
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000033283
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211786
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,638,795 V398E possibly damaging Het
Ankef1 A G 2: 136,550,376 N495S probably benign Het
Bpifb3 G T 2: 153,931,443 V428L probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ccdc178 A G 18: 22,097,728 L362S probably benign Het
Ccdc33 G A 9: 58,086,600 P88S probably damaging Het
Cdk14 A T 5: 4,894,029 D385E probably damaging Het
Chrna4 A G 2: 181,024,806 L613P probably damaging Het
Cnot3 T A 7: 3,645,336 probably null Het
Csf1 T A 3: 107,753,854 I116L probably damaging Het
Csrp2 G T 10: 110,939,279 A192S probably benign Het
Dnah9 T C 11: 66,147,399 T104A probably benign Het
Eml1 C T 12: 108,527,724 P593S probably damaging Het
Entpd2 T A 2: 25,399,466 I320N probably benign Het
Exosc9 A T 3: 36,554,672 N140I probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Fgfr2 G T 7: 130,228,690 T186K probably benign Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Gbf1 A G 19: 46,279,321 I1203V possibly damaging Het
Gja1 T A 10: 56,388,505 M320K probably benign Het
Gm5431 A G 11: 48,894,781 Y256H probably benign Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Greb1 T G 12: 16,708,621 D698A probably damaging Het
Hook2 A G 8: 84,998,125 E500G probably damaging Het
Kif13b A T 14: 64,751,558 N796I probably damaging Het
Kif1a C T 1: 93,024,574 probably null Het
Lama1 T C 17: 67,780,617 probably null Het
Mfsd1 C T 3: 67,594,385 Q246* probably null Het
Mkrn3 A G 7: 62,419,534 S170P probably benign Het
Ms4a6b A G 19: 11,521,695 M58V probably benign Het
Muc4 T C 16: 32,756,795 V2223A unknown Het
Mycbp2 A T 14: 103,275,887 V811D probably benign Het
Olfr1015 T C 2: 85,786,341 F277L probably damaging Het
Olfr483 A T 7: 108,104,133 N275Y probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcsk2 A G 2: 143,801,111 E436G probably damaging Het
Pet100 T G 8: 3,621,764 probably null Het
Pira2 A G 7: 3,841,554 Y493H probably damaging Het
Prkdc C A 16: 15,739,471 R2213S probably benign Het
Prmt2 A G 10: 76,209,446 I342T possibly damaging Het
Psmc6 A G 14: 45,348,673 E381G possibly damaging Het
Sema3c A G 5: 17,727,632 D711G probably benign Het
Sgcb T C 5: 73,640,810 E103G possibly damaging Het
Sh3pxd2a A G 19: 47,267,409 S957P probably damaging Het
Slc26a2 A G 18: 61,199,417 V314A possibly damaging Het
Smarca5 G T 8: 80,711,743 H655N probably damaging Het
Sspo T A 6: 48,465,576 S2002T probably damaging Het
Sync T C 4: 129,293,751 L192P probably damaging Het
Ush2a T C 1: 188,358,603 M477T probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vcam1 A G 3: 116,124,400 V304A probably damaging Het
Vmn2r115 T A 17: 23,346,029 W297R probably damaging Het
Vmn2r120 T A 17: 57,525,973 M69L probably benign Het
Wdr11 A G 7: 129,624,791 D771G probably damaging Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102466905 makesense probably null
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R3914:Rrm1 UTSW 7 102457174 missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4379:Rrm1 UTSW 7 102446593 missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R4939:Rrm1 UTSW 7 102466924 missense probably benign 0.34
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGGCCCATTGGAATTGG -3'
(R):5'- TGCAGAACAGGGATTGCTGG -3'

Sequencing Primer
(F):5'- CCCATTGGAATTGGGGTACAAG -3'
(R):5'- GGATTTAGGGCGCACTTGAATAAATC -3'
Posted On2017-08-16