Mutagenetix > Incidental Mutation

Incidental Mutation 'R6120:Smarca5'

485717

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

044268-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6120 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80711743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 655 (H655N)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: H655N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: H655N

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140110

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150277

Meta Mutation Damage Score

0.1474

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	A	18: 6,638,795	V398E	possibly damaging	Het
Ankef1	A	G	2: 136,550,376	N495S	probably benign	Het
Bpifb3	G	T	2: 153,931,443	V428L	probably benign	Het
Btd	G	A	14: 31,641,108		probably benign	Het
Ccdc178	A	G	18: 22,097,728	L362S	probably benign	Het
Ccdc33	G	A	9: 58,086,600	P88S	probably damaging	Het
Cdk14	A	T	5: 4,894,029	D385E	probably damaging	Het
Chrna4	A	G	2: 181,024,806	L613P	probably damaging	Het
Cnot3	T	A	7: 3,645,336		probably null	Het
Csf1	T	A	3: 107,753,854	I116L	probably damaging	Het
Csrp2	G	T	10: 110,939,279	A192S	probably benign	Het
Dnah9	T	C	11: 66,147,399	T104A	probably benign	Het
Eml1	C	T	12: 108,527,724	P593S	probably damaging	Het
Entpd2	T	A	2: 25,399,466	I320N	probably benign	Het
Exosc9	A	T	3: 36,554,672	N140I	probably damaging	Het
Fam186a	T	C	15: 99,940,363	T2667A	probably benign	Het
Fes	T	C	7: 80,380,867	D558G	probably damaging	Het
Fgfr2	G	T	7: 130,228,690	T186K	probably benign	Het
Fnip1	A	G	11: 54,510,000	E1075G	probably benign	Het
Gbf1	A	G	19: 46,279,321	I1203V	possibly damaging	Het
Gja1	T	A	10: 56,388,505	M320K	probably benign	Het
Gm5431	A	G	11: 48,894,781	Y256H	probably benign	Het
Gpr20	C	T	15: 73,696,004	V179M	probably damaging	Het
Greb1	T	G	12: 16,708,621	D698A	probably damaging	Het
Hook2	A	G	8: 84,998,125	E500G	probably damaging	Het
Kif13b	A	T	14: 64,751,558	N796I	probably damaging	Het
Kif1a	C	T	1: 93,024,574		probably null	Het
Lama1	T	C	17: 67,780,617		probably null	Het
Mfsd1	C	T	3: 67,594,385	Q246*	probably null	Het
Mkrn3	A	G	7: 62,419,534	S170P	probably benign	Het
Ms4a6b	A	G	19: 11,521,695	M58V	probably benign	Het
Muc4	T	C	16: 32,756,795	V2223A	unknown	Het
Mycbp2	A	T	14: 103,275,887	V811D	probably benign	Het
Olfr1015	T	C	2: 85,786,341	F277L	probably damaging	Het
Olfr483	A	T	7: 108,104,133	N275Y	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcsk2	A	G	2: 143,801,111	E436G	probably damaging	Het
Pet100	T	G	8: 3,621,764		probably null	Het
Pira2	A	G	7: 3,841,554	Y493H	probably damaging	Het
Prkdc	C	A	16: 15,739,471	R2213S	probably benign	Het
Prmt2	A	G	10: 76,209,446	I342T	possibly damaging	Het
Psmc6	A	G	14: 45,348,673	E381G	possibly damaging	Het
Rrm1	G	A	7: 102,460,856		probably null	Het
Sema3c	A	G	5: 17,727,632	D711G	probably benign	Het
Sgcb	T	C	5: 73,640,810	E103G	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,409	S957P	probably damaging	Het
Slc26a2	A	G	18: 61,199,417	V314A	possibly damaging	Het
Sspo	T	A	6: 48,465,576	S2002T	probably damaging	Het
Sync	T	C	4: 129,293,751	L192P	probably damaging	Het
Ush2a	T	C	1: 188,358,603	M477T	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vcam1	A	G	3: 116,124,400	V304A	probably damaging	Het
Vmn2r115	T	A	17: 23,346,029	W297R	probably damaging	Het
Vmn2r120	T	A	17: 57,525,973	M69L	probably benign	Het
Wdr11	A	G	7: 129,624,791	D771G	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTGTGCTGATCATGTTCC -3'
(R):5'- ATTTCGGCCAACCACCTGTC -3'

Sequencing Primer
(F):5'- TGGACTCCTCCAGATGCC -3'
(R):5'- GGCTGCCCTAAGACCTTACATG -3'

Posted On

2017-08-16