Incidental Mutation 'R6120:Smarca5'
ID 485717
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
MMRRC Submission 044268-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6120 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80711743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 655 (H655N)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: H655N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: H655N

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150277
Meta Mutation Damage Score 0.1474 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,638,795 V398E possibly damaging Het
Ankef1 A G 2: 136,550,376 N495S probably benign Het
Bpifb3 G T 2: 153,931,443 V428L probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ccdc178 A G 18: 22,097,728 L362S probably benign Het
Ccdc33 G A 9: 58,086,600 P88S probably damaging Het
Cdk14 A T 5: 4,894,029 D385E probably damaging Het
Chrna4 A G 2: 181,024,806 L613P probably damaging Het
Cnot3 T A 7: 3,645,336 probably null Het
Csf1 T A 3: 107,753,854 I116L probably damaging Het
Csrp2 G T 10: 110,939,279 A192S probably benign Het
Dnah9 T C 11: 66,147,399 T104A probably benign Het
Eml1 C T 12: 108,527,724 P593S probably damaging Het
Entpd2 T A 2: 25,399,466 I320N probably benign Het
Exosc9 A T 3: 36,554,672 N140I probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Fgfr2 G T 7: 130,228,690 T186K probably benign Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Gbf1 A G 19: 46,279,321 I1203V possibly damaging Het
Gja1 T A 10: 56,388,505 M320K probably benign Het
Gm5431 A G 11: 48,894,781 Y256H probably benign Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Greb1 T G 12: 16,708,621 D698A probably damaging Het
Hook2 A G 8: 84,998,125 E500G probably damaging Het
Kif13b A T 14: 64,751,558 N796I probably damaging Het
Kif1a C T 1: 93,024,574 probably null Het
Lama1 T C 17: 67,780,617 probably null Het
Mfsd1 C T 3: 67,594,385 Q246* probably null Het
Mkrn3 A G 7: 62,419,534 S170P probably benign Het
Ms4a6b A G 19: 11,521,695 M58V probably benign Het
Muc4 T C 16: 32,756,795 V2223A unknown Het
Mycbp2 A T 14: 103,275,887 V811D probably benign Het
Olfr1015 T C 2: 85,786,341 F277L probably damaging Het
Olfr483 A T 7: 108,104,133 N275Y probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcsk2 A G 2: 143,801,111 E436G probably damaging Het
Pet100 T G 8: 3,621,764 probably null Het
Pira2 A G 7: 3,841,554 Y493H probably damaging Het
Prkdc C A 16: 15,739,471 R2213S probably benign Het
Prmt2 A G 10: 76,209,446 I342T possibly damaging Het
Psmc6 A G 14: 45,348,673 E381G possibly damaging Het
Rrm1 G A 7: 102,460,856 probably null Het
Sema3c A G 5: 17,727,632 D711G probably benign Het
Sgcb T C 5: 73,640,810 E103G possibly damaging Het
Sh3pxd2a A G 19: 47,267,409 S957P probably damaging Het
Slc26a2 A G 18: 61,199,417 V314A possibly damaging Het
Sspo T A 6: 48,465,576 S2002T probably damaging Het
Sync T C 4: 129,293,751 L192P probably damaging Het
Ush2a T C 1: 188,358,603 M477T probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vcam1 A G 3: 116,124,400 V304A probably damaging Het
Vmn2r115 T A 17: 23,346,029 W297R probably damaging Het
Vmn2r120 T A 17: 57,525,973 M69L probably benign Het
Wdr11 A G 7: 129,624,791 D771G probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTGTGCTGATCATGTTCC -3'
(R):5'- ATTTCGGCCAACCACCTGTC -3'

Sequencing Primer
(F):5'- TGGACTCCTCCAGATGCC -3'
(R):5'- GGCTGCCCTAAGACCTTACATG -3'
Posted On 2017-08-16