Incidental Mutation 'R6120:Olfr811'
ID485723
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 044268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6120 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129801820 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 235 (A235V)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably damaging
Transcript: ENSMUST00000076437
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: A235V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215058
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably damaging
Transcript: ENSMUST00000217571
AA Change: A235V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3021 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,638,795 V398E possibly damaging Het
Ankef1 A G 2: 136,550,376 N495S probably benign Het
Bpifb3 G T 2: 153,931,443 V428L probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ccdc178 A G 18: 22,097,728 L362S probably benign Het
Ccdc33 G A 9: 58,086,600 P88S probably damaging Het
Cdk14 A T 5: 4,894,029 D385E probably damaging Het
Chrna4 A G 2: 181,024,806 L613P probably damaging Het
Cnot3 T A 7: 3,645,336 probably null Het
Csf1 T A 3: 107,753,854 I116L probably damaging Het
Csrp2 G T 10: 110,939,279 A192S probably benign Het
Dnah9 T C 11: 66,147,399 T104A probably benign Het
Eml1 C T 12: 108,527,724 P593S probably damaging Het
Entpd2 T A 2: 25,399,466 I320N probably benign Het
Exosc9 A T 3: 36,554,672 N140I probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Fes T C 7: 80,380,867 D558G probably damaging Het
Fgfr2 G T 7: 130,228,690 T186K probably benign Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Gbf1 A G 19: 46,279,321 I1203V possibly damaging Het
Gja1 T A 10: 56,388,505 M320K probably benign Het
Gm5431 A G 11: 48,894,781 Y256H probably benign Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Greb1 T G 12: 16,708,621 D698A probably damaging Het
Hook2 A G 8: 84,998,125 E500G probably damaging Het
Kif13b A T 14: 64,751,558 N796I probably damaging Het
Kif1a C T 1: 93,024,574 probably null Het
Lama1 T C 17: 67,780,617 probably null Het
Mfsd1 C T 3: 67,594,385 Q246* probably null Het
Mkrn3 A G 7: 62,419,534 S170P probably benign Het
Ms4a6b A G 19: 11,521,695 M58V probably benign Het
Muc4 T C 16: 32,756,795 V2223A unknown Het
Mycbp2 A T 14: 103,275,887 V811D probably benign Het
Olfr1015 T C 2: 85,786,341 F277L probably damaging Het
Olfr483 A T 7: 108,104,133 N275Y probably damaging Het
Pcsk2 A G 2: 143,801,111 E436G probably damaging Het
Pet100 T G 8: 3,621,764 probably null Het
Pira2 A G 7: 3,841,554 Y493H probably damaging Het
Prkdc C A 16: 15,739,471 R2213S probably benign Het
Prmt2 A G 10: 76,209,446 I342T possibly damaging Het
Psmc6 A G 14: 45,348,673 E381G possibly damaging Het
Rrm1 G A 7: 102,460,856 probably null Het
Sema3c A G 5: 17,727,632 D711G probably benign Het
Sgcb T C 5: 73,640,810 E103G possibly damaging Het
Sh3pxd2a A G 19: 47,267,409 S957P probably damaging Het
Slc26a2 A G 18: 61,199,417 V314A possibly damaging Het
Smarca5 G T 8: 80,711,743 H655N probably damaging Het
Sspo T A 6: 48,465,576 S2002T probably damaging Het
Sync T C 4: 129,293,751 L192P probably damaging Het
Ush2a T C 1: 188,358,603 M477T probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vcam1 A G 3: 116,124,400 V304A probably damaging Het
Vmn2r115 T A 17: 23,346,029 W297R probably damaging Het
Vmn2r120 T A 17: 57,525,973 M69L probably benign Het
Wdr11 A G 7: 129,624,791 D771G probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTTCCTTCACCTGCTG -3'
(R):5'- TTTGTGCCTCCAAAACAATAGACC -3'

Sequencing Primer
(F):5'- CACCTGCTGATTCCTTAGGGTG -3'
(R):5'- ATAGACCACTTCCTGTGTGACAG -3'
Posted On2017-08-16