Mutagenetix > Incidental Mutation

Incidental Mutation 'R6122:Ppp1r9a'

485761

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r9a

Ensembl Gene

ENSMUSG00000032827

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 9A

Synonyms

A230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik

MMRRC Submission

044269-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.723) question?

Stock #

R6122 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4902917-5165661 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4905509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 21 (N21K)

Ref Sequence

ENSEMBL: ENSMUSP00000135634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000175962] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177338] [ENSMUST00000177456]

AlphaFold

H3BJD6

Predicted Effect

probably damaging
Transcript: ENSMUST00000035813
AA Change: N21K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	5e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1052	6.41e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164110

Predicted Effect

probably damaging
Transcript: ENSMUST00000168998
AA Change: N21K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175889
AA Change: N21K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1041	1.72e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000175962
AA Change: N21K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135360
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDB:3HVQ\|D	436	466	3e-12	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000176263
AA Change: N21K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
low complexity region	643	649	N/A	INTRINSIC
Blast:PDZ	763	800	2e-15	BLAST
low complexity region	806	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176729

SMART Domains

Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	96	115	N/A	INTRINSIC
PDB:3HVQ\|D	116	232	4e-79	PDB
SCOP:d1be9a_	174	232	5e-9	SMART
Blast:PDZ	193	232	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000177153
AA Change: N21K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177338
AA Change: N21K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135634
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177456
AA Change: N21K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
low complexity region	966	987	N/A	INTRINSIC
low complexity region	1040	1049	N/A	INTRINSIC
low complexity region	1103	1114	N/A	INTRINSIC
SAM	1183	1249	6.41e-16	SMART

Meta Mutation Damage Score

0.4462

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.8%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,252	*301W	probably null	Het
Abat	A	G	16: 8,605,550	I236V	probably benign	Het
Abca8a	T	C	11: 110,070,423	T558A	probably benign	Het
Ace3	A	C	11: 105,994,938	M57L	probably benign	Het
Adgrg1	T	C	8: 95,002,501	S18P	probably benign	Het
Ahi1	A	G	10: 21,058,165	D60G	probably benign	Het
Ap4e1	T	A	2: 127,028,160		probably null	Het
Arnt2	C	A	7: 84,361,565	K34N	probably damaging	Het
Ascc3	T	A	10: 50,617,925	M152K	probably benign	Het
AW551984	A	T	9: 39,593,755	F480L	probably benign	Het
Blvrb	G	A	7: 27,459,348	A58T	possibly damaging	Het
Bpifa1	C	T	2: 154,143,972	T69I	probably benign	Het
Cacna1g	T	A	11: 94,430,171	M1366L	probably benign	Het
Ccdc82	A	G	9: 13,266,412	I361V	probably benign	Het
Clca4b	T	A	3: 144,926,166	I193F	possibly damaging	Het
Crb1	A	T	1: 139,248,948	Y371*	probably null	Het
Cul9	T	C	17: 46,521,928	D1363G	possibly damaging	Het
Cyp2j8	C	T	4: 96,444,640	A490T	probably benign	Het
D430041D05Rik	A	T	2: 104,256,292	S780T	probably benign	Het
Fzd5	G	T	1: 64,735,656	C315*	probably null	Het
Gabrr1	T	C	4: 33,161,695	S340P	probably damaging	Het
Galnt7	T	C	8: 57,526,166	D641G	probably damaging	Het
Gm7133	A	G	1: 97,183,223		noncoding transcript	Het
Heatr5b	A	G	17: 78,813,173	L774P	possibly damaging	Het
Itch	T	A	2: 155,174,065	S157T	probably benign	Het
Itgam	A	C	7: 128,085,652	D398A	probably damaging	Het
Kalrn	G	T	16: 33,985,191	L2659M	possibly damaging	Het
Kcnj14	C	A	7: 45,819,451	R210L	possibly damaging	Het
Kmt2d	T	C	15: 98,860,692		probably benign	Het
Krt2	G	C	15: 101,815,914	T305S	probably damaging	Het
Mcm3ap	A	G	10: 76,506,607	N1645D	probably damaging	Het
Naf1	T	A	8: 66,883,444	I341K	probably damaging	Het
Nbea	G	T	3: 56,029,896	H765N	probably damaging	Het
Ncapd3	A	G	9: 27,063,982	I776V	probably benign	Het
Neo1	A	T	9: 58,917,008	D712E	probably benign	Het
Neu1	G	A	17: 34,934,754	V385I	probably benign	Het
Olfr114	C	A	17: 37,589,926	R142S	probably benign	Het
Olfr575	C	A	7: 102,954,804	G273C	probably damaging	Het
Olfr575	A	G	7: 102,955,530	Y24H	probably benign	Het
Pgghg	A	C	7: 140,943,395	T196P	possibly damaging	Het
Pira2	A	T	7: 3,842,446	V313E	probably damaging	Het
Pkd1l2	T	C	8: 117,082,368	R28G	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Prune1	T	C	3: 95,262,243	D216G	probably benign	Het
Ptpn23	G	T	9: 110,387,825		probably benign	Het
Ranbp2	T	A	10: 58,465,529	M668K	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpsa	G	T	9: 120,131,036	V222L	probably benign	Het
Sept2	A	G	1: 93,497,376	T45A	probably damaging	Het
Slc12a8	A	T	16: 33,625,014	D260V	probably damaging	Het
Srrm2	G	T	17: 23,820,356	M2087I	possibly damaging	Het
Tg	T	C	15: 66,828,457	L88P	probably damaging	Het
Tns1	A	G	1: 73,952,419		probably null	Het
Topbp1	A	T	9: 103,346,961	D1429V	probably benign	Het
Tprg	A	G	16: 25,422,401		probably null	Het
Trit1	T	C	4: 123,039,468	I66T	possibly damaging	Het
Usf3	A	T	16: 44,217,307	I717L	probably damaging	Het

Other mutations in Ppp1r9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Ppp1r9a	APN	6	5158195	missense	possibly damaging	0.72
IGL00796:Ppp1r9a	APN	6	5157014	missense	probably benign	0.37
IGL00906:Ppp1r9a	APN	6	5157023	missense	possibly damaging	0.62
IGL01662:Ppp1r9a	APN	6	5115322	missense	probably damaging	1.00
IGL01695:Ppp1r9a	APN	6	5064003	missense	probably damaging	1.00
IGL01807:Ppp1r9a	APN	6	5158248	nonsense	probably null
IGL02126:Ppp1r9a	APN	6	5156229	missense	probably damaging	1.00
IGL02423:Ppp1r9a	APN	6	4906537	missense	probably benign	0.25
IGL03343:Ppp1r9a	APN	6	5046015	missense	probably damaging	1.00
IGL03365:Ppp1r9a	APN	6	5110993	splice site	probably benign
R0545:Ppp1r9a	UTSW	6	5115357	missense	probably benign	0.45
R1126:Ppp1r9a	UTSW	6	4906795	missense	possibly damaging	0.93
R1137:Ppp1r9a	UTSW	6	5159697	missense	possibly damaging	0.46
R1443:Ppp1r9a	UTSW	6	5057557	missense	probably damaging	1.00
R1484:Ppp1r9a	UTSW	6	5113712	nonsense	probably null
R1545:Ppp1r9a	UTSW	6	5156242	critical splice donor site	probably null
R1627:Ppp1r9a	UTSW	6	4906168	missense	possibly damaging	0.50
R1672:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R1826:Ppp1r9a	UTSW	6	5111060	splice site	probably benign
R1834:Ppp1r9a	UTSW	6	5113710	missense	probably damaging	0.98
R1874:Ppp1r9a	UTSW	6	4906348	missense	possibly damaging	0.87
R2224:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2227:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2898:Ppp1r9a	UTSW	6	4906558	missense	probably benign	0.01
R3606:Ppp1r9a	UTSW	6	5113674	missense	possibly damaging	0.90
R3732:Ppp1r9a	UTSW	6	4906259	unclassified	probably benign
R3927:Ppp1r9a	UTSW	6	5057531	missense	probably damaging	1.00
R4631:Ppp1r9a	UTSW	6	4906537	missense	possibly damaging	0.62
R4682:Ppp1r9a	UTSW	6	4905477	missense	possibly damaging	0.48
R4766:Ppp1r9a	UTSW	6	5157016	missense	probably benign	0.11
R5197:Ppp1r9a	UTSW	6	5156177	missense	probably damaging	1.00
R5217:Ppp1r9a	UTSW	6	5115367	missense	probably damaging	1.00
R5493:Ppp1r9a	UTSW	6	5159702	missense	probably damaging	0.99
R5790:Ppp1r9a	UTSW	6	5134363	intron	probably benign
R5828:Ppp1r9a	UTSW	6	5158200	missense	probably damaging	1.00
R5896:Ppp1r9a	UTSW	6	5159648	missense	probably damaging	1.00
R5930:Ppp1r9a	UTSW	6	5157002	critical splice acceptor site	probably null
R5990:Ppp1r9a	UTSW	6	5134660	missense	probably benign	0.05
R6017:Ppp1r9a	UTSW	6	4906363	missense	probably benign	0.18
R6164:Ppp1r9a	UTSW	6	5110715	intron	probably benign
R6175:Ppp1r9a	UTSW	6	4905639	nonsense	probably null
R6188:Ppp1r9a	UTSW	6	5158113	nonsense	probably null
R6233:Ppp1r9a	UTSW	6	5077610	missense	probably damaging	1.00
R6321:Ppp1r9a	UTSW	6	5115151	missense	probably damaging	1.00
R6449:Ppp1r9a	UTSW	6	5057458	missense	probably benign	0.44
R6454:Ppp1r9a	UTSW	6	4905827	missense	probably damaging	1.00
R6527:Ppp1r9a	UTSW	6	5045949	missense	probably damaging	1.00
R7053:Ppp1r9a	UTSW	6	4905670	missense	probably damaging	1.00
R7233:Ppp1r9a	UTSW	6	5134804	missense	probably benign
R7238:Ppp1r9a	UTSW	6	5159716	missense	probably damaging	1.00
R7438:Ppp1r9a	UTSW	6	5115378	missense	probably damaging	0.99
R7497:Ppp1r9a	UTSW	6	4905775	missense	probably damaging	1.00
R7666:Ppp1r9a	UTSW	6	5143238	missense	probably benign	0.00
R7698:Ppp1r9a	UTSW	6	4906430	missense	probably benign
R7850:Ppp1r9a	UTSW	6	4905894	missense	possibly damaging	0.77
R8029:Ppp1r9a	UTSW	6	5057518	missense	possibly damaging	0.76
R8392:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R8411:Ppp1r9a	UTSW	6	5057568	missense	probably damaging	1.00
R8431:Ppp1r9a	UTSW	6	5115456	missense	probably benign	0.01
R8699:Ppp1r9a	UTSW	6	5115474	missense	probably benign	0.00
R8708:Ppp1r9a	UTSW	6	5115196	missense	probably damaging	1.00
R9039:Ppp1r9a	UTSW	6	5134657	missense	probably benign	0.00
R9096:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9097:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9131:Ppp1r9a	UTSW	6	5134106	missense	possibly damaging	0.86
R9279:Ppp1r9a	UTSW	6	5113757	missense	probably damaging	1.00
R9512:Ppp1r9a	UTSW	6	5113681	missense	probably benign	0.27
R9512:Ppp1r9a	UTSW	6	5115364	missense	probably damaging	0.99
R9567:Ppp1r9a	UTSW	6	5157004	missense	probably benign	0.34
R9672:Ppp1r9a	UTSW	6	5007889	missense	unknown
R9687:Ppp1r9a	UTSW	6	4905978	missense	probably damaging	1.00
R9715:Ppp1r9a	UTSW	6	5045936	missense	probably damaging	0.96
RF007:Ppp1r9a	UTSW	6	4906657	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATCGTCACGGGACAAGTG -3'
(R):5'- GTTTTGGCAATGATAGCAGCATTC -3'

Sequencing Primer
(F):5'- ACAAGTGTGCCATTTGAGCG -3'
(R):5'- AGCATTCTCGCTGGGTTCCATAC -3'

Posted On

2017-08-16