Mutagenetix > Incidental Mutations

Incidental Mutation 'R6122:Arnt2'

485767

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

044269-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6122 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 84361565 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 34 (K34N)

Ref Sequence

ENSEMBL: ENSMUSP00000147129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085077
AA Change: K45N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: K45N

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207769
AA Change: K45N

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

unknown
Transcript: ENSMUST00000208204
AA Change: A45S

Predicted Effect

probably damaging
Transcript: ENSMUST00000208232
AA Change: K34N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208392
AA Change: K34N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208863
AA Change: K34N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208995
AA Change: K34N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209133
AA Change: K34N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1850

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.8%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,252	*301W	probably null	Het
Abat	A	G	16: 8,605,550	I236V	probably benign	Het
Abca8a	T	C	11: 110,070,423	T558A	probably benign	Het
Ace3	A	C	11: 105,994,938	M57L	probably benign	Het
Adgrg1	T	C	8: 95,002,501	S18P	probably benign	Het
Ahi1	A	G	10: 21,058,165	D60G	probably benign	Het
Ap4e1	T	A	2: 127,028,160		probably null	Het
Ascc3	T	A	10: 50,617,925	M152K	probably benign	Het
AW551984	A	T	9: 39,593,755	F480L	probably benign	Het
Blvrb	G	A	7: 27,459,348	A58T	possibly damaging	Het
Bpifa1	C	T	2: 154,143,972	T69I	probably benign	Het
Cacna1g	T	A	11: 94,430,171	M1366L	probably benign	Het
Ccdc82	A	G	9: 13,266,412	I361V	probably benign	Het
Clca4b	T	A	3: 144,926,166	I193F	possibly damaging	Het
Crb1	A	T	1: 139,248,948	Y371*	probably null	Het
Cul9	T	C	17: 46,521,928	D1363G	possibly damaging	Het
Cyp2j8	C	T	4: 96,444,640	A490T	probably benign	Het
D430041D05Rik	A	T	2: 104,256,292	S780T	probably benign	Het
Fzd5	G	T	1: 64,735,656	C315*	probably null	Het
Gabrr1	T	C	4: 33,161,695	S340P	probably damaging	Het
Galnt7	T	C	8: 57,526,166	D641G	probably damaging	Het
Gm7133	A	G	1: 97,183,223		noncoding transcript	Het
Heatr5b	A	G	17: 78,813,173	L774P	possibly damaging	Het
Itch	T	A	2: 155,174,065	S157T	probably benign	Het
Itgam	A	C	7: 128,085,652	D398A	probably damaging	Het
Kalrn	G	T	16: 33,985,191	L2659M	possibly damaging	Het
Kcnj14	C	A	7: 45,819,451	R210L	possibly damaging	Het
Kmt2d	T	C	15: 98,860,692		probably benign	Het
Krt2	G	C	15: 101,815,914	T305S	probably damaging	Het
Mcm3ap	A	G	10: 76,506,607	N1645D	probably damaging	Het
Naf1	T	A	8: 66,883,444	I341K	probably damaging	Het
Nbea	G	T	3: 56,029,896	H765N	probably damaging	Het
Ncapd3	A	G	9: 27,063,982	I776V	probably benign	Het
Neo1	A	T	9: 58,917,008	D712E	probably benign	Het
Neu1	G	A	17: 34,934,754	V385I	probably benign	Het
Olfr114	C	A	17: 37,589,926	R142S	probably benign	Het
Olfr575	C	A	7: 102,954,804	G273C	probably damaging	Het
Olfr575	A	G	7: 102,955,530	Y24H	probably benign	Het
Pgghg	A	C	7: 140,943,395	T196P	possibly damaging	Het
Pira2	A	T	7: 3,842,446	V313E	probably damaging	Het
Pkd1l2	T	C	8: 117,082,368	R28G	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Ppp1r9a	T	A	6: 4,905,509	N21K	probably damaging	Het
Prune1	T	C	3: 95,262,243	D216G	probably benign	Het
Ptpn23	G	T	9: 110,387,825		probably benign	Het
Ranbp2	T	A	10: 58,465,529	M668K	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpsa	G	T	9: 120,131,036	V222L	probably benign	Het
Sept2	A	G	1: 93,497,376	T45A	probably damaging	Het
Slc12a8	A	T	16: 33,625,014	D260V	probably damaging	Het
Srrm2	G	T	17: 23,820,356	M2087I	possibly damaging	Het
Tg	T	C	15: 66,828,457	L88P	probably damaging	Het
Tns1	A	G	1: 73,952,419		probably null	Het
Topbp1	A	T	9: 103,346,961	D1429V	probably benign	Het
Tprg	A	G	16: 25,422,401		probably null	Het
Trit1	T	C	4: 123,039,468	I66T	possibly damaging	Het
Usf3	A	T	16: 44,217,307	I717L	probably damaging	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7898:Arnt2	UTSW	7	84268947	splice site	probably null
R8386:Arnt2	UTSW	7	84347539	missense	probably damaging	1.00
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GAGCACTTAGAAGCAAATCATGTGC -3'
(R):5'- AAGCGAAGTGTCAACCCCTC -3'

Sequencing Primer
(F):5'- TCATGTGCATATTTAGGAATCTTGC -3'
(R):5'- GAAGTGTCAACCCCTCCAGGTC -3'

Posted On

2017-08-16