Incidental Mutation 'R6122:Galnt7'
ID485772
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Namepolypeptide N-acetylgalactosaminyltransferase 7
SynonymsppGaNTase-T7
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location57523828-57653032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57526166 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 641 (D641G)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
Predicted Effect probably damaging
Transcript: ENSMUST00000034021
AA Change: D641G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: D641G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110316
AA Change: D641G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: D641G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139417
Meta Mutation Damage Score 0.6734 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0400:Galnt7 UTSW 8 57583989 missense probably damaging 0.99
R0553:Galnt7 UTSW 8 57552430 splice site probably benign
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5177:Galnt7 UTSW 8 57584027 missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6684:Galnt7 UTSW 8 57538109 missense probably benign 0.16
R6752:Galnt7 UTSW 8 57652951 missense probably damaging 1.00
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57532705 missense probably benign 0.00
R8221:Galnt7 UTSW 8 57552566 missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57538188 missense probably benign 0.34
R8402:Galnt7 UTSW 8 57542919 missense probably damaging 0.98
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTTCCAACTGATCAGAGAGGTTC -3'
(R):5'- TGGAATGTGATGCCCTCTTC -3'

Sequencing Primer
(F):5'- AACTGATCAGAGAGGTTCCAGGTTTG -3'
(R):5'- TGGGTCTGAAGAGTGCAATAGTGTAC -3'
Posted On2017-08-16