Incidental Mutation 'R6122:Naf1'
ID485773
Institutional Source Beutler Lab
Gene Symbol Naf1
Ensembl Gene ENSMUSG00000014907
Gene Namenuclear assembly factor 1 ribonucleoprotein
SynonymsLOC234344
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location66860217-66890564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66883444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 341 (I341K)
Ref Sequence ENSEMBL: ENSMUSP00000112640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118009]
Predicted Effect probably damaging
Transcript: ENSMUST00000118009
AA Change: I341K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112640
Gene: ENSMUSG00000014907
AA Change: I341K

DomainStartEndE-ValueType
low complexity region 35 180 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
low complexity region 218 246 N/A INTRINSIC
Pfam:Gar1 280 431 2.3e-48 PFAM
low complexity region 517 532 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 570 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212916
Meta Mutation Damage Score 0.8195 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality between implantation and placentation while heterozygotes show no evident ribosomal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Naf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Naf1 APN 8 66885800 missense probably damaging 1.00
IGL01861:Naf1 APN 8 66864533 splice site probably benign
IGL02817:Naf1 APN 8 66883525 missense probably damaging 1.00
R0016:Naf1 UTSW 8 66889055 splice site probably benign
R0092:Naf1 UTSW 8 66889108 missense probably benign 0.24
R2062:Naf1 UTSW 8 66887780 missense probably damaging 1.00
R2065:Naf1 UTSW 8 66887780 missense probably damaging 1.00
R2066:Naf1 UTSW 8 66887780 missense probably damaging 1.00
R2068:Naf1 UTSW 8 66887780 missense probably damaging 1.00
R2209:Naf1 UTSW 8 66860536 unclassified probably benign
R4296:Naf1 UTSW 8 66889462 missense possibly damaging 0.92
R5186:Naf1 UTSW 8 66879646 missense probably benign 0.10
R5560:Naf1 UTSW 8 66883545 missense probably damaging 1.00
R6143:Naf1 UTSW 8 66877695 missense possibly damaging 0.95
R6389:Naf1 UTSW 8 66861028 missense possibly damaging 0.66
R6827:Naf1 UTSW 8 66877691 missense possibly damaging 0.65
R7083:Naf1 UTSW 8 66860486 unclassified probably benign
R7444:Naf1 UTSW 8 66860548 unclassified probably benign
R7727:Naf1 UTSW 8 66860548 unclassified probably benign
R7818:Naf1 UTSW 8 66889376 missense probably damaging 0.97
R7860:Naf1 UTSW 8 66860513 missense unknown
R7943:Naf1 UTSW 8 66860513 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCACTTTCCAAAATGCCAGC -3'
(R):5'- GCAACGAAGCACTTACTGTTTG -3'

Sequencing Primer
(F):5'- GCCAGCATTTTATGACAACAATG -3'
(R):5'- GAAGCACTTACTGTTTGAGCTTTTC -3'
Posted On2017-08-16