Incidental Mutation 'R6122:Naf1'
ID 485773
Institutional Source Beutler Lab
Gene Symbol Naf1
Ensembl Gene ENSMUSG00000014907
Gene Name nuclear assembly factor 1 ribonucleoprotein
Synonyms LOC234344
MMRRC Submission 044269-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.923) question?
Stock # R6122 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 67312869-67343216 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67336096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 341 (I341K)
Ref Sequence ENSEMBL: ENSMUSP00000112640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118009]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000118009
AA Change: I341K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112640
Gene: ENSMUSG00000014907
AA Change: I341K

DomainStartEndE-ValueType
low complexity region 35 180 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
low complexity region 218 246 N/A INTRINSIC
Pfam:Gar1 280 431 2.3e-48 PFAM
low complexity region 517 532 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 570 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212916
Meta Mutation Damage Score 0.8195 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality between implantation and placentation while heterozygotes show no evident ribosomal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,853,750 (GRCm39) *301W probably null Het
Abat A G 16: 8,423,414 (GRCm39) I236V probably benign Het
Abca8a T C 11: 109,961,249 (GRCm39) T558A probably benign Het
Ace3 A C 11: 105,885,764 (GRCm39) M57L probably benign Het
Adgrg1 T C 8: 95,729,129 (GRCm39) S18P probably benign Het
Ahi1 A G 10: 20,934,064 (GRCm39) D60G probably benign Het
Ap4e1 T A 2: 126,870,080 (GRCm39) probably null Het
Arnt2 C A 7: 84,010,773 (GRCm39) K34N probably damaging Het
Ascc3 T A 10: 50,494,021 (GRCm39) M152K probably benign Het
AW551984 A T 9: 39,505,051 (GRCm39) F480L probably benign Het
Blvrb G A 7: 27,158,773 (GRCm39) A58T possibly damaging Het
Bpifa1 C T 2: 153,985,892 (GRCm39) T69I probably benign Het
Cacna1g T A 11: 94,320,997 (GRCm39) M1366L probably benign Het
Ccdc82 A G 9: 13,266,880 (GRCm39) I361V probably benign Het
Clca4b T A 3: 144,631,927 (GRCm39) I193F possibly damaging Het
Crb1 A T 1: 139,176,686 (GRCm39) Y371* probably null Het
Cul9 T C 17: 46,832,854 (GRCm39) D1363G possibly damaging Het
Cyp2j8 C T 4: 96,332,877 (GRCm39) A490T probably benign Het
D430041D05Rik A T 2: 104,086,637 (GRCm39) S780T probably benign Het
Fzd5 G T 1: 64,774,815 (GRCm39) C315* probably null Het
Gabrr1 T C 4: 33,161,695 (GRCm39) S340P probably damaging Het
Galnt7 T C 8: 57,979,200 (GRCm39) D641G probably damaging Het
Gm7133 A G 1: 97,110,948 (GRCm39) noncoding transcript Het
Heatr5b A G 17: 79,120,602 (GRCm39) L774P possibly damaging Het
Itch T A 2: 155,015,985 (GRCm39) S157T probably benign Het
Itgam A C 7: 127,684,824 (GRCm39) D398A probably damaging Het
Kalrn G T 16: 33,805,561 (GRCm39) L2659M possibly damaging Het
Kcnj14 C A 7: 45,468,875 (GRCm39) R210L possibly damaging Het
Kmt2d T C 15: 98,758,573 (GRCm39) probably benign Het
Krt1c G C 15: 101,724,349 (GRCm39) T305S probably damaging Het
Mcm3ap A G 10: 76,342,441 (GRCm39) N1645D probably damaging Het
Nbea G T 3: 55,937,317 (GRCm39) H765N probably damaging Het
Ncapd3 A G 9: 26,975,278 (GRCm39) I776V probably benign Het
Neo1 A T 9: 58,824,291 (GRCm39) D712E probably benign Het
Neu1 G A 17: 35,153,730 (GRCm39) V385I probably benign Het
Or14j3 C A 17: 37,900,817 (GRCm39) R142S probably benign Het
Or51a6 C A 7: 102,604,011 (GRCm39) G273C probably damaging Het
Or51a6 A G 7: 102,604,737 (GRCm39) Y24H probably benign Het
Pgghg A C 7: 140,523,308 (GRCm39) T196P possibly damaging Het
Pira2 A T 7: 3,845,445 (GRCm39) V313E probably damaging Het
Pkd1l2 T C 8: 117,809,107 (GRCm39) R28G probably benign Het
Pkhd1l1 T C 15: 44,421,336 (GRCm39) S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 (GRCm39) N21K probably damaging Het
Prune1 T C 3: 95,169,554 (GRCm39) D216G probably benign Het
Ptpn23 G T 9: 110,216,893 (GRCm39) probably benign Het
Ranbp2 T A 10: 58,301,351 (GRCm39) M668K probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpsa G T 9: 119,960,102 (GRCm39) V222L probably benign Het
Septin2 A G 1: 93,425,098 (GRCm39) T45A probably damaging Het
Slc12a8 A T 16: 33,445,384 (GRCm39) D260V probably damaging Het
Srrm2 G T 17: 24,039,330 (GRCm39) M2087I possibly damaging Het
Tg T C 15: 66,700,306 (GRCm39) L88P probably damaging Het
Tns1 A G 1: 73,991,578 (GRCm39) probably null Het
Topbp1 A T 9: 103,224,160 (GRCm39) D1429V probably benign Het
Tprg1 A G 16: 25,241,151 (GRCm39) probably null Het
Trit1 T C 4: 122,933,261 (GRCm39) I66T possibly damaging Het
Usf3 A T 16: 44,037,670 (GRCm39) I717L probably damaging Het
Other mutations in Naf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Naf1 APN 8 67,338,452 (GRCm39) missense probably damaging 1.00
IGL01861:Naf1 APN 8 67,317,185 (GRCm39) splice site probably benign
IGL02817:Naf1 APN 8 67,336,177 (GRCm39) missense probably damaging 1.00
R0016:Naf1 UTSW 8 67,341,707 (GRCm39) splice site probably benign
R0092:Naf1 UTSW 8 67,341,760 (GRCm39) missense probably benign 0.24
R2062:Naf1 UTSW 8 67,340,432 (GRCm39) missense probably damaging 1.00
R2065:Naf1 UTSW 8 67,340,432 (GRCm39) missense probably damaging 1.00
R2066:Naf1 UTSW 8 67,340,432 (GRCm39) missense probably damaging 1.00
R2068:Naf1 UTSW 8 67,340,432 (GRCm39) missense probably damaging 1.00
R2209:Naf1 UTSW 8 67,313,188 (GRCm39) unclassified probably benign
R4296:Naf1 UTSW 8 67,342,114 (GRCm39) missense possibly damaging 0.92
R5186:Naf1 UTSW 8 67,332,298 (GRCm39) missense probably benign 0.10
R5560:Naf1 UTSW 8 67,336,197 (GRCm39) missense probably damaging 1.00
R6143:Naf1 UTSW 8 67,330,347 (GRCm39) missense possibly damaging 0.95
R6389:Naf1 UTSW 8 67,313,680 (GRCm39) missense possibly damaging 0.66
R6827:Naf1 UTSW 8 67,330,343 (GRCm39) missense possibly damaging 0.65
R7083:Naf1 UTSW 8 67,313,138 (GRCm39) unclassified probably benign
R7444:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R7727:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R7818:Naf1 UTSW 8 67,342,028 (GRCm39) missense probably damaging 0.97
R7860:Naf1 UTSW 8 67,313,165 (GRCm39) missense unknown
R7923:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R7977:Naf1 UTSW 8 67,313,146 (GRCm39) unclassified probably benign
R8420:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R8462:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R8815:Naf1 UTSW 8 67,317,333 (GRCm39) missense possibly damaging 0.65
R8989:Naf1 UTSW 8 67,313,628 (GRCm39) missense possibly damaging 0.53
R9138:Naf1 UTSW 8 67,317,198 (GRCm39) missense possibly damaging 0.85
R9231:Naf1 UTSW 8 67,313,146 (GRCm39) unclassified probably benign
R9283:Naf1 UTSW 8 67,313,503 (GRCm39) missense unknown
R9445:Naf1 UTSW 8 67,336,097 (GRCm39) missense probably damaging 1.00
R9454:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
R9680:Naf1 UTSW 8 67,313,200 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCACTTTCCAAAATGCCAGC -3'
(R):5'- GCAACGAAGCACTTACTGTTTG -3'

Sequencing Primer
(F):5'- GCCAGCATTTTATGACAACAATG -3'
(R):5'- GAAGCACTTACTGTTTGAGCTTTTC -3'
Posted On 2017-08-16