Incidental Mutation 'R6122:AW551984'
ID 485778
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Name expressed sequence AW551984
Synonyms
MMRRC Submission 044269-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6122 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39498692-39515699 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39505051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 480 (F480L)
Ref Sequence ENSEMBL: ENSMUSP00000113212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722]
AlphaFold Q8BGF0
Predicted Effect probably benign
Transcript: ENSMUST00000042485
AA Change: F480L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: F480L

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119722
AA Change: F480L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: F480L

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147753
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,853,750 (GRCm39) *301W probably null Het
Abat A G 16: 8,423,414 (GRCm39) I236V probably benign Het
Abca8a T C 11: 109,961,249 (GRCm39) T558A probably benign Het
Ace3 A C 11: 105,885,764 (GRCm39) M57L probably benign Het
Adgrg1 T C 8: 95,729,129 (GRCm39) S18P probably benign Het
Ahi1 A G 10: 20,934,064 (GRCm39) D60G probably benign Het
Ap4e1 T A 2: 126,870,080 (GRCm39) probably null Het
Arnt2 C A 7: 84,010,773 (GRCm39) K34N probably damaging Het
Ascc3 T A 10: 50,494,021 (GRCm39) M152K probably benign Het
Blvrb G A 7: 27,158,773 (GRCm39) A58T possibly damaging Het
Bpifa1 C T 2: 153,985,892 (GRCm39) T69I probably benign Het
Cacna1g T A 11: 94,320,997 (GRCm39) M1366L probably benign Het
Ccdc82 A G 9: 13,266,880 (GRCm39) I361V probably benign Het
Clca4b T A 3: 144,631,927 (GRCm39) I193F possibly damaging Het
Crb1 A T 1: 139,176,686 (GRCm39) Y371* probably null Het
Cul9 T C 17: 46,832,854 (GRCm39) D1363G possibly damaging Het
Cyp2j8 C T 4: 96,332,877 (GRCm39) A490T probably benign Het
D430041D05Rik A T 2: 104,086,637 (GRCm39) S780T probably benign Het
Fzd5 G T 1: 64,774,815 (GRCm39) C315* probably null Het
Gabrr1 T C 4: 33,161,695 (GRCm39) S340P probably damaging Het
Galnt7 T C 8: 57,979,200 (GRCm39) D641G probably damaging Het
Gm7133 A G 1: 97,110,948 (GRCm39) noncoding transcript Het
Heatr5b A G 17: 79,120,602 (GRCm39) L774P possibly damaging Het
Itch T A 2: 155,015,985 (GRCm39) S157T probably benign Het
Itgam A C 7: 127,684,824 (GRCm39) D398A probably damaging Het
Kalrn G T 16: 33,805,561 (GRCm39) L2659M possibly damaging Het
Kcnj14 C A 7: 45,468,875 (GRCm39) R210L possibly damaging Het
Kmt2d T C 15: 98,758,573 (GRCm39) probably benign Het
Krt1c G C 15: 101,724,349 (GRCm39) T305S probably damaging Het
Mcm3ap A G 10: 76,342,441 (GRCm39) N1645D probably damaging Het
Naf1 T A 8: 67,336,096 (GRCm39) I341K probably damaging Het
Nbea G T 3: 55,937,317 (GRCm39) H765N probably damaging Het
Ncapd3 A G 9: 26,975,278 (GRCm39) I776V probably benign Het
Neo1 A T 9: 58,824,291 (GRCm39) D712E probably benign Het
Neu1 G A 17: 35,153,730 (GRCm39) V385I probably benign Het
Or14j3 C A 17: 37,900,817 (GRCm39) R142S probably benign Het
Or51a6 C A 7: 102,604,011 (GRCm39) G273C probably damaging Het
Or51a6 A G 7: 102,604,737 (GRCm39) Y24H probably benign Het
Pgghg A C 7: 140,523,308 (GRCm39) T196P possibly damaging Het
Pira2 A T 7: 3,845,445 (GRCm39) V313E probably damaging Het
Pkd1l2 T C 8: 117,809,107 (GRCm39) R28G probably benign Het
Pkhd1l1 T C 15: 44,421,336 (GRCm39) S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 (GRCm39) N21K probably damaging Het
Prune1 T C 3: 95,169,554 (GRCm39) D216G probably benign Het
Ptpn23 G T 9: 110,216,893 (GRCm39) probably benign Het
Ranbp2 T A 10: 58,301,351 (GRCm39) M668K probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpsa G T 9: 119,960,102 (GRCm39) V222L probably benign Het
Septin2 A G 1: 93,425,098 (GRCm39) T45A probably damaging Het
Slc12a8 A T 16: 33,445,384 (GRCm39) D260V probably damaging Het
Srrm2 G T 17: 24,039,330 (GRCm39) M2087I possibly damaging Het
Tg T C 15: 66,700,306 (GRCm39) L88P probably damaging Het
Tns1 A G 1: 73,991,578 (GRCm39) probably null Het
Topbp1 A T 9: 103,224,160 (GRCm39) D1429V probably benign Het
Tprg1 A G 16: 25,241,151 (GRCm39) probably null Het
Trit1 T C 4: 122,933,261 (GRCm39) I66T possibly damaging Het
Usf3 A T 16: 44,037,670 (GRCm39) I717L probably damaging Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39,504,145 (GRCm39) missense probably benign 0.16
IGL00869:AW551984 APN 9 39,504,730 (GRCm39) splice site probably benign
IGL01411:AW551984 APN 9 39,505,087 (GRCm39) missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39,502,568 (GRCm39) missense probably benign 0.01
IGL02102:AW551984 APN 9 39,500,987 (GRCm39) missense probably damaging 1.00
IGL02149:AW551984 APN 9 39,504,220 (GRCm39) missense probably benign 0.06
IGL02151:AW551984 APN 9 39,504,241 (GRCm39) missense probably benign 0.35
IGL02154:AW551984 APN 9 39,500,398 (GRCm39) missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39,510,621 (GRCm39) missense probably null 0.99
IGL02574:AW551984 APN 9 39,500,382 (GRCm39) missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39,504,624 (GRCm39) critical splice donor site probably null
IGL02754:AW551984 APN 9 39,507,922 (GRCm39) nonsense probably null
IGL02838:AW551984 APN 9 39,505,939 (GRCm39) missense probably damaging 1.00
IGL03240:AW551984 APN 9 39,500,418 (GRCm39) missense probably benign 0.00
IGL03328:AW551984 APN 9 39,508,412 (GRCm39) missense probably damaging 1.00
IGL03374:AW551984 APN 9 39,511,062 (GRCm39) missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39,504,275 (GRCm39) missense probably benign 0.08
R0141:AW551984 UTSW 9 39,501,940 (GRCm39) missense probably damaging 1.00
R0269:AW551984 UTSW 9 39,511,246 (GRCm39) missense probably damaging 1.00
R0365:AW551984 UTSW 9 39,510,617 (GRCm39) missense probably benign 0.14
R0453:AW551984 UTSW 9 39,511,937 (GRCm39) missense probably damaging 1.00
R0481:AW551984 UTSW 9 39,511,912 (GRCm39) missense probably null 1.00
R1005:AW551984 UTSW 9 39,505,029 (GRCm39) nonsense probably null
R1585:AW551984 UTSW 9 39,510,632 (GRCm39) nonsense probably null
R2177:AW551984 UTSW 9 39,511,111 (GRCm39) missense probably benign
R3117:AW551984 UTSW 9 39,504,656 (GRCm39) missense probably benign 0.08
R3119:AW551984 UTSW 9 39,504,656 (GRCm39) missense probably benign 0.08
R3162:AW551984 UTSW 9 39,504,325 (GRCm39) missense probably damaging 1.00
R3162:AW551984 UTSW 9 39,504,325 (GRCm39) missense probably damaging 1.00
R3836:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R3837:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R3839:AW551984 UTSW 9 39,509,204 (GRCm39) unclassified probably benign
R4299:AW551984 UTSW 9 39,504,275 (GRCm39) missense probably benign 0.08
R4422:AW551984 UTSW 9 39,511,373 (GRCm39) missense probably null 0.00
R4713:AW551984 UTSW 9 39,508,449 (GRCm39) missense probably benign 0.13
R4905:AW551984 UTSW 9 39,508,454 (GRCm39) missense probably damaging 0.99
R4966:AW551984 UTSW 9 39,508,472 (GRCm39) missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39,509,261 (GRCm39) missense probably benign 0.00
R5041:AW551984 UTSW 9 39,511,894 (GRCm39) missense probably damaging 1.00
R5342:AW551984 UTSW 9 39,505,847 (GRCm39) missense probably damaging 1.00
R5383:AW551984 UTSW 9 39,501,994 (GRCm39) missense probably benign
R5443:AW551984 UTSW 9 39,509,325 (GRCm39) missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39,508,481 (GRCm39) missense probably damaging 1.00
R5536:AW551984 UTSW 9 39,504,169 (GRCm39) missense probably benign 0.04
R5586:AW551984 UTSW 9 39,502,559 (GRCm39) missense probably benign 0.01
R5601:AW551984 UTSW 9 39,502,563 (GRCm39) missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39,502,000 (GRCm39) missense probably damaging 1.00
R5701:AW551984 UTSW 9 39,504,118 (GRCm39) missense probably benign 0.01
R6142:AW551984 UTSW 9 39,508,410 (GRCm39) missense probably benign 0.00
R6272:AW551984 UTSW 9 39,509,333 (GRCm39) missense probably benign 0.06
R6429:AW551984 UTSW 9 39,511,910 (GRCm39) missense probably damaging 1.00
R6659:AW551984 UTSW 9 39,500,395 (GRCm39) missense probably benign 0.00
R6670:AW551984 UTSW 9 39,504,292 (GRCm39) missense probably damaging 1.00
R6791:AW551984 UTSW 9 39,511,955 (GRCm39) missense probably damaging 1.00
R7000:AW551984 UTSW 9 39,512,085 (GRCm39) missense probably benign 0.11
R7077:AW551984 UTSW 9 39,502,723 (GRCm39) missense probably benign
R7083:AW551984 UTSW 9 39,508,943 (GRCm39) missense probably damaging 1.00
R7352:AW551984 UTSW 9 39,504,221 (GRCm39) missense probably benign
R7475:AW551984 UTSW 9 39,509,236 (GRCm39) missense probably damaging 1.00
R7534:AW551984 UTSW 9 39,502,777 (GRCm39) missense probably benign 0.03
R7542:AW551984 UTSW 9 39,505,927 (GRCm39) missense possibly damaging 0.95
R7708:AW551984 UTSW 9 39,505,051 (GRCm39) missense probably benign 0.00
R7729:AW551984 UTSW 9 39,511,071 (GRCm39) missense possibly damaging 0.89
R7955:AW551984 UTSW 9 39,507,960 (GRCm39) missense probably damaging 1.00
R8122:AW551984 UTSW 9 39,510,665 (GRCm39) missense probably damaging 1.00
R8358:AW551984 UTSW 9 39,510,651 (GRCm39) missense probably damaging 0.99
R8402:AW551984 UTSW 9 39,508,949 (GRCm39) missense probably damaging 1.00
R8683:AW551984 UTSW 9 39,511,005 (GRCm39) missense possibly damaging 0.86
R8810:AW551984 UTSW 9 39,511,307 (GRCm39) missense probably damaging 1.00
R8857:AW551984 UTSW 9 39,511,831 (GRCm39) missense probably damaging 1.00
R8871:AW551984 UTSW 9 39,500,998 (GRCm39) nonsense probably null
R9019:AW551984 UTSW 9 39,508,973 (GRCm39) nonsense probably null
Z1088:AW551984 UTSW 9 39,501,899 (GRCm39) nonsense probably null
ZE80:AW551984 UTSW 9 39,504,963 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCATGTGTTCAGGAGAGC -3'
(R):5'- AAGGCTCGTGAACTCTATATACAG -3'

Sequencing Primer
(F):5'- CCTGGACAGCTGTAGTTAGCAAATAC -3'
(R):5'- CTGAGGCGTTCTTTACAG -3'
Posted On 2017-08-16