Incidental Mutation 'R6122:Ascc3'
ID 485784
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Name activating signal cointegrator 1 complex subunit 3
Synonyms Helic1, B630009I04Rik, ASC1p200
MMRRC Submission 044269-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R6122 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 50468756-50727300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50494021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 152 (M152K)
Ref Sequence ENSEMBL: ENSMUSP00000151273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606] [ENSMUST00000219226] [ENSMUST00000220355]
AlphaFold E9PZJ8
Predicted Effect probably benign
Transcript: ENSMUST00000035606
AA Change: M152K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: M152K

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219226
Predicted Effect probably benign
Transcript: ENSMUST00000220355
AA Change: M152K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,853,750 (GRCm39) *301W probably null Het
Abat A G 16: 8,423,414 (GRCm39) I236V probably benign Het
Abca8a T C 11: 109,961,249 (GRCm39) T558A probably benign Het
Ace3 A C 11: 105,885,764 (GRCm39) M57L probably benign Het
Adgrg1 T C 8: 95,729,129 (GRCm39) S18P probably benign Het
Ahi1 A G 10: 20,934,064 (GRCm39) D60G probably benign Het
Ap4e1 T A 2: 126,870,080 (GRCm39) probably null Het
Arnt2 C A 7: 84,010,773 (GRCm39) K34N probably damaging Het
AW551984 A T 9: 39,505,051 (GRCm39) F480L probably benign Het
Blvrb G A 7: 27,158,773 (GRCm39) A58T possibly damaging Het
Bpifa1 C T 2: 153,985,892 (GRCm39) T69I probably benign Het
Cacna1g T A 11: 94,320,997 (GRCm39) M1366L probably benign Het
Ccdc82 A G 9: 13,266,880 (GRCm39) I361V probably benign Het
Clca4b T A 3: 144,631,927 (GRCm39) I193F possibly damaging Het
Crb1 A T 1: 139,176,686 (GRCm39) Y371* probably null Het
Cul9 T C 17: 46,832,854 (GRCm39) D1363G possibly damaging Het
Cyp2j8 C T 4: 96,332,877 (GRCm39) A490T probably benign Het
D430041D05Rik A T 2: 104,086,637 (GRCm39) S780T probably benign Het
Fzd5 G T 1: 64,774,815 (GRCm39) C315* probably null Het
Gabrr1 T C 4: 33,161,695 (GRCm39) S340P probably damaging Het
Galnt7 T C 8: 57,979,200 (GRCm39) D641G probably damaging Het
Gm7133 A G 1: 97,110,948 (GRCm39) noncoding transcript Het
Heatr5b A G 17: 79,120,602 (GRCm39) L774P possibly damaging Het
Itch T A 2: 155,015,985 (GRCm39) S157T probably benign Het
Itgam A C 7: 127,684,824 (GRCm39) D398A probably damaging Het
Kalrn G T 16: 33,805,561 (GRCm39) L2659M possibly damaging Het
Kcnj14 C A 7: 45,468,875 (GRCm39) R210L possibly damaging Het
Kmt2d T C 15: 98,758,573 (GRCm39) probably benign Het
Krt1c G C 15: 101,724,349 (GRCm39) T305S probably damaging Het
Mcm3ap A G 10: 76,342,441 (GRCm39) N1645D probably damaging Het
Naf1 T A 8: 67,336,096 (GRCm39) I341K probably damaging Het
Nbea G T 3: 55,937,317 (GRCm39) H765N probably damaging Het
Ncapd3 A G 9: 26,975,278 (GRCm39) I776V probably benign Het
Neo1 A T 9: 58,824,291 (GRCm39) D712E probably benign Het
Neu1 G A 17: 35,153,730 (GRCm39) V385I probably benign Het
Or14j3 C A 17: 37,900,817 (GRCm39) R142S probably benign Het
Or51a6 C A 7: 102,604,011 (GRCm39) G273C probably damaging Het
Or51a6 A G 7: 102,604,737 (GRCm39) Y24H probably benign Het
Pgghg A C 7: 140,523,308 (GRCm39) T196P possibly damaging Het
Pira2 A T 7: 3,845,445 (GRCm39) V313E probably damaging Het
Pkd1l2 T C 8: 117,809,107 (GRCm39) R28G probably benign Het
Pkhd1l1 T C 15: 44,421,336 (GRCm39) S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 (GRCm39) N21K probably damaging Het
Prune1 T C 3: 95,169,554 (GRCm39) D216G probably benign Het
Ptpn23 G T 9: 110,216,893 (GRCm39) probably benign Het
Ranbp2 T A 10: 58,301,351 (GRCm39) M668K probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpsa G T 9: 119,960,102 (GRCm39) V222L probably benign Het
Septin2 A G 1: 93,425,098 (GRCm39) T45A probably damaging Het
Slc12a8 A T 16: 33,445,384 (GRCm39) D260V probably damaging Het
Srrm2 G T 17: 24,039,330 (GRCm39) M2087I possibly damaging Het
Tg T C 15: 66,700,306 (GRCm39) L88P probably damaging Het
Tns1 A G 1: 73,991,578 (GRCm39) probably null Het
Topbp1 A T 9: 103,224,160 (GRCm39) D1429V probably benign Het
Tprg1 A G 16: 25,241,151 (GRCm39) probably null Het
Trit1 T C 4: 122,933,261 (GRCm39) I66T possibly damaging Het
Usf3 A T 16: 44,037,670 (GRCm39) I717L probably damaging Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50,590,531 (GRCm39) missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50,576,039 (GRCm39) nonsense probably null
IGL00897:Ascc3 APN 10 50,604,187 (GRCm39) missense probably benign 0.01
IGL01077:Ascc3 APN 10 50,525,413 (GRCm39) splice site probably benign
IGL01124:Ascc3 APN 10 50,608,569 (GRCm39) missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50,626,618 (GRCm39) missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50,566,235 (GRCm39) missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50,726,623 (GRCm39) nonsense probably null
IGL02247:Ascc3 APN 10 50,526,686 (GRCm39) missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50,604,250 (GRCm39) nonsense probably null
IGL02428:Ascc3 APN 10 50,721,791 (GRCm39) nonsense probably null
IGL02432:Ascc3 APN 10 50,576,589 (GRCm39) missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50,576,695 (GRCm39) missense probably benign 0.00
IGL02640:Ascc3 APN 10 50,643,470 (GRCm39) missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50,536,769 (GRCm39) missense probably benign 0.01
IGL03144:Ascc3 APN 10 50,643,539 (GRCm39) missense probably benign 0.16
IGL03161:Ascc3 APN 10 50,494,168 (GRCm39) missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50,699,949 (GRCm39) missense possibly damaging 0.89
algorithm UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
heuristic UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
network UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50,484,089 (GRCm39) missense probably benign 0.31
R0165:Ascc3 UTSW 10 50,718,223 (GRCm39) splice site probably null
R0255:Ascc3 UTSW 10 50,521,154 (GRCm39) missense probably benign 0.00
R0310:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0314:Ascc3 UTSW 10 50,514,095 (GRCm39) missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50,625,051 (GRCm39) splice site probably benign
R0418:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0419:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0421:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0480:Ascc3 UTSW 10 50,611,348 (GRCm39) missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R0833:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R1231:Ascc3 UTSW 10 50,699,756 (GRCm39) missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50,518,615 (GRCm39) splice site probably benign
R1302:Ascc3 UTSW 10 50,480,890 (GRCm39) start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50,576,586 (GRCm39) missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50,566,257 (GRCm39) missense probably benign 0.00
R1855:Ascc3 UTSW 10 50,494,018 (GRCm39) missense probably benign 0.01
R1953:Ascc3 UTSW 10 50,721,726 (GRCm39) missense probably benign
R1976:Ascc3 UTSW 10 50,525,262 (GRCm39) missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50,493,838 (GRCm39) missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50,525,908 (GRCm39) missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50,566,307 (GRCm39) missense probably benign 0.00
R2040:Ascc3 UTSW 10 50,604,227 (GRCm39) missense probably benign
R2043:Ascc3 UTSW 10 50,576,616 (GRCm39) missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50,597,935 (GRCm39) missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50,630,148 (GRCm39) missense probably benign 0.07
R2310:Ascc3 UTSW 10 50,624,988 (GRCm39) missense probably benign 0.15
R2405:Ascc3 UTSW 10 50,607,774 (GRCm39) missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50,494,297 (GRCm39) missense probably benign 0.14
R3410:Ascc3 UTSW 10 50,576,196 (GRCm39) missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50,494,281 (GRCm39) missense probably benign 0.00
R3771:Ascc3 UTSW 10 50,596,814 (GRCm39) splice site probably benign
R3783:Ascc3 UTSW 10 50,604,350 (GRCm39) missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50,597,981 (GRCm39) missense probably benign 0.14
R4509:Ascc3 UTSW 10 50,718,339 (GRCm39) missense probably benign 0.00
R4520:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4521:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4522:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4524:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4581:Ascc3 UTSW 10 50,587,121 (GRCm39) missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50,596,760 (GRCm39) missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50,535,110 (GRCm39) missense probably benign 0.02
R4768:Ascc3 UTSW 10 50,576,595 (GRCm39) missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50,589,329 (GRCm39) missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50,625,227 (GRCm39) missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50,699,894 (GRCm39) missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50,699,744 (GRCm39) missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50,514,059 (GRCm39) missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50,592,757 (GRCm39) missense probably benign 0.00
R5302:Ascc3 UTSW 10 50,583,873 (GRCm39) missense probably benign 0.09
R5436:Ascc3 UTSW 10 50,535,079 (GRCm39) missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50,725,679 (GRCm39) missense probably benign 0.06
R5474:Ascc3 UTSW 10 50,725,634 (GRCm39) missense probably benign 0.25
R5744:Ascc3 UTSW 10 50,586,977 (GRCm39) missense probably benign
R5781:Ascc3 UTSW 10 50,514,074 (GRCm39) missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5868:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5869:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6109:Ascc3 UTSW 10 50,525,343 (GRCm39) missense probably benign 0.37
R6128:Ascc3 UTSW 10 50,526,734 (GRCm39) missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50,596,769 (GRCm39) missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50,721,676 (GRCm39) missense probably benign 0.09
R6472:Ascc3 UTSW 10 50,596,783 (GRCm39) missense probably benign 0.03
R6474:Ascc3 UTSW 10 50,624,932 (GRCm39) missense probably benign 0.01
R6480:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6572:Ascc3 UTSW 10 50,566,343 (GRCm39) nonsense probably null
R6585:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6656:Ascc3 UTSW 10 50,526,021 (GRCm39) nonsense probably null
R6669:Ascc3 UTSW 10 50,716,469 (GRCm39) missense probably benign
R6675:Ascc3 UTSW 10 50,626,659 (GRCm39) nonsense probably null
R6790:Ascc3 UTSW 10 50,521,808 (GRCm39) missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50,625,158 (GRCm39) missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50,725,742 (GRCm39) missense probably null 0.51
R6919:Ascc3 UTSW 10 50,521,849 (GRCm39) nonsense probably null
R6936:Ascc3 UTSW 10 50,606,057 (GRCm39) missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50,521,762 (GRCm39) missense probably benign 0.00
R6957:Ascc3 UTSW 10 50,604,278 (GRCm39) missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50,592,725 (GRCm39) missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50,716,446 (GRCm39) missense probably benign 0.43
R7358:Ascc3 UTSW 10 50,590,448 (GRCm39) nonsense probably null
R7479:Ascc3 UTSW 10 50,525,895 (GRCm39) missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50,721,796 (GRCm39) missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50,604,393 (GRCm39) missense probably benign 0.04
R8021:Ascc3 UTSW 10 50,607,744 (GRCm39) missense probably benign 0.02
R8134:Ascc3 UTSW 10 50,643,554 (GRCm39) missense probably benign 0.02
R8252:Ascc3 UTSW 10 50,518,706 (GRCm39) missense probably benign
R8348:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8351:Ascc3 UTSW 10 50,725,693 (GRCm39) missense probably benign
R8356:Ascc3 UTSW 10 50,526,003 (GRCm39) missense probably benign 0.38
R8362:Ascc3 UTSW 10 50,518,692 (GRCm39) missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50,525,400 (GRCm39) missense possibly damaging 0.93
R8448:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8957:Ascc3 UTSW 10 50,576,208 (GRCm39) missense probably damaging 1.00
R9004:Ascc3 UTSW 10 50,718,276 (GRCm39) missense probably benign
R9133:Ascc3 UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R9200:Ascc3 UTSW 10 50,521,787 (GRCm39) missense possibly damaging 0.55
R9328:Ascc3 UTSW 10 50,535,015 (GRCm39) missense probably damaging 1.00
R9377:Ascc3 UTSW 10 50,608,858 (GRCm39) missense possibly damaging 0.62
R9412:Ascc3 UTSW 10 50,525,230 (GRCm39) missense probably benign 0.00
R9576:Ascc3 UTSW 10 50,494,254 (GRCm39) missense possibly damaging 0.71
R9796:Ascc3 UTSW 10 50,608,801 (GRCm39) nonsense probably null
X0021:Ascc3 UTSW 10 50,576,686 (GRCm39) missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50,526,692 (GRCm39) missense probably benign 0.00
X0026:Ascc3 UTSW 10 50,608,574 (GRCm39) missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50,594,517 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTGGGGCTGCATTTCTC -3'
(R):5'- CACAATAGGGAGCCATTTGTTTTC -3'

Sequencing Primer
(F):5'- CTCTTTATGACATTTCACATGACGG -3'
(R):5'- TCTCCACAGGCTTGAGCTCAG -3'
Posted On 2017-08-16