Incidental Mutation 'R6122:Mcm3ap'
ID485786
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6122 (G1)
Quality Score198.009
Status Validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76506607 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1645 (N1645D)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
Predicted Effect probably damaging
Transcript: ENSMUST00000170795
AA Change: N1645D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: N1645D

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219811
Meta Mutation Damage Score 0.4385 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
Doom UTSW 10 76501314 missense probably benign
woeful UTSW 10 76481015 missense probably benign 0.44
PIT4377001:Mcm3ap UTSW 10 76502762 missense possibly damaging 0.78
PIT4791001:Mcm3ap UTSW 10 76506473 missense probably damaging 1.00
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76483226 missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
R7212:Mcm3ap UTSW 10 76501311 missense probably benign 0.01
R7403:Mcm3ap UTSW 10 76482823 critical splice donor site probably null
R7470:Mcm3ap UTSW 10 76508397 missense probably damaging 1.00
R7561:Mcm3ap UTSW 10 76492878 missense possibly damaging 0.94
R7610:Mcm3ap UTSW 10 76496720 splice site probably null
R7620:Mcm3ap UTSW 10 76470433 missense probably benign 0.00
R7898:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R8266:Mcm3ap UTSW 10 76476580 nonsense probably null
R8355:Mcm3ap UTSW 10 76493501 missense probably benign 0.32
R8367:Mcm3ap UTSW 10 76477859 missense possibly damaging 0.65
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTTGAGGATGGGATCAGC -3'
(R):5'- TGCAGACTTCACCCTGGAATC -3'

Sequencing Primer
(F):5'- CGGTTTTTCCACGACAGGAGAG -3'
(R):5'- AATCCACCCGCTGGTATAGTG -3'
Posted On2017-08-16