Incidental Mutation 'R6122:Olfr114'
ID485802
Institutional Source Beutler Lab
Gene Symbol Olfr114
Ensembl Gene ENSMUSG00000062629
Gene Nameolfactory receptor 114
SynonymsMOR218-10, GA_x6K02T2PSCP-2049802-2048870
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37589233-37592743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37589926 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 142 (R142S)
Ref Sequence ENSEMBL: ENSMUSP00000149735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076914] [ENSMUST00000214871] [ENSMUST00000216249]
Predicted Effect probably benign
Transcript: ENSMUST00000076914
AA Change: R142S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076181
Gene: ENSMUSG00000062629
AA Change: R142S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.7e-6 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214871
AA Change: R142S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216249
AA Change: R142S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.2062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cul9 T C 17: 46,521,928 D1363G possibly damaging Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Olfr114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr114 APN 17 37590072 missense possibly damaging 0.93
IGL01624:Olfr114 APN 17 37589925 missense probably benign 0.00
IGL02026:Olfr114 APN 17 37589407 utr 3 prime probably benign
IGL02608:Olfr114 APN 17 37590219 missense probably damaging 1.00
IGL02632:Olfr114 APN 17 37590341 missense probably benign 0.00
IGL02990:Olfr114 APN 17 37589668 missense probably benign 0.00
R0114:Olfr114 UTSW 17 37589415 makesense probably null
R1156:Olfr114 UTSW 17 37589517 missense possibly damaging 0.93
R1366:Olfr114 UTSW 17 37589764 missense probably benign 0.03
R3413:Olfr114 UTSW 17 37589696 missense probably benign 0.00
R3701:Olfr114 UTSW 17 37589826 nonsense probably null
R6639:Olfr114 UTSW 17 37589931 missense probably damaging 1.00
R7066:Olfr114 UTSW 17 37590143 missense probably damaging 1.00
R7316:Olfr114 UTSW 17 37590135 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCATCCTGAGAACTGTG -3'
(R):5'- CCTCAGTATGTTGACAGTTCCC -3'

Sequencing Primer
(F):5'- GGCAAAACCTATTACTGACAGG -3'
(R):5'- ACAGTTCCCTGGCACGAAG -3'
Posted On2017-08-16