Incidental Mutation 'R6122:Cul9'
ID485803
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
MMRRC Submission 044269-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R6122 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46521928 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1363 (D1363G)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably benign
Transcript: ENSMUST00000066026
AA Change: D1363G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: D1363G

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182315
Predicted Effect possibly damaging
Transcript: ENSMUST00000182485
AA Change: D1363G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: D1363G

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183078
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,252 *301W probably null Het
Abat A G 16: 8,605,550 I236V probably benign Het
Abca8a T C 11: 110,070,423 T558A probably benign Het
Ace3 A C 11: 105,994,938 M57L probably benign Het
Adgrg1 T C 8: 95,002,501 S18P probably benign Het
Ahi1 A G 10: 21,058,165 D60G probably benign Het
Ap4e1 T A 2: 127,028,160 probably null Het
Arnt2 C A 7: 84,361,565 K34N probably damaging Het
Ascc3 T A 10: 50,617,925 M152K probably benign Het
AW551984 A T 9: 39,593,755 F480L probably benign Het
Blvrb G A 7: 27,459,348 A58T possibly damaging Het
Bpifa1 C T 2: 154,143,972 T69I probably benign Het
Cacna1g T A 11: 94,430,171 M1366L probably benign Het
Ccdc82 A G 9: 13,266,412 I361V probably benign Het
Clca4b T A 3: 144,926,166 I193F possibly damaging Het
Crb1 A T 1: 139,248,948 Y371* probably null Het
Cyp2j8 C T 4: 96,444,640 A490T probably benign Het
D430041D05Rik A T 2: 104,256,292 S780T probably benign Het
Fzd5 G T 1: 64,735,656 C315* probably null Het
Gabrr1 T C 4: 33,161,695 S340P probably damaging Het
Galnt7 T C 8: 57,526,166 D641G probably damaging Het
Gm7133 A G 1: 97,183,223 noncoding transcript Het
Heatr5b A G 17: 78,813,173 L774P possibly damaging Het
Itch T A 2: 155,174,065 S157T probably benign Het
Itgam A C 7: 128,085,652 D398A probably damaging Het
Kalrn G T 16: 33,985,191 L2659M possibly damaging Het
Kcnj14 C A 7: 45,819,451 R210L possibly damaging Het
Kmt2d T C 15: 98,860,692 probably benign Het
Krt2 G C 15: 101,815,914 T305S probably damaging Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Naf1 T A 8: 66,883,444 I341K probably damaging Het
Nbea G T 3: 56,029,896 H765N probably damaging Het
Ncapd3 A G 9: 27,063,982 I776V probably benign Het
Neo1 A T 9: 58,917,008 D712E probably benign Het
Neu1 G A 17: 34,934,754 V385I probably benign Het
Olfr114 C A 17: 37,589,926 R142S probably benign Het
Olfr575 C A 7: 102,954,804 G273C probably damaging Het
Olfr575 A G 7: 102,955,530 Y24H probably benign Het
Pgghg A C 7: 140,943,395 T196P possibly damaging Het
Pira2 A T 7: 3,842,446 V313E probably damaging Het
Pkd1l2 T C 8: 117,082,368 R28G probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Ppp1r9a T A 6: 4,905,509 N21K probably damaging Het
Prune1 T C 3: 95,262,243 D216G probably benign Het
Ptpn23 G T 9: 110,387,825 probably benign Het
Ranbp2 T A 10: 58,465,529 M668K probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpsa G T 9: 120,131,036 V222L probably benign Het
Sept2 A G 1: 93,497,376 T45A probably damaging Het
Slc12a8 A T 16: 33,625,014 D260V probably damaging Het
Srrm2 G T 17: 23,820,356 M2087I possibly damaging Het
Tg T C 15: 66,828,457 L88P probably damaging Het
Tns1 A G 1: 73,952,419 probably null Het
Topbp1 A T 9: 103,346,961 D1429V probably benign Het
Tprg A G 16: 25,422,401 probably null Het
Trit1 T C 4: 123,039,468 I66T possibly damaging Het
Usf3 A T 16: 44,217,307 I717L probably damaging Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCGAAGAGTGAACAGGCC -3'
(R):5'- TCTATCCGAGGTGGGTACAG -3'

Sequencing Primer
(F):5'- GCCAATGAGGGGACAAATCC -3'
(R):5'- TACAGCTCAGGAGGGACC -3'
Posted On2017-08-16