Incidental Mutation 'R6123:R3hdm1'
ID485805
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128169036 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 103 (N103I)
Ref Sequence ENSEMBL: ENSMUSP00000139749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000188381] [ENSMUST00000189317]
Predicted Effect probably damaging
Transcript: ENSMUST00000036288
AA Change: N159I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: N159I

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187023
AA Change: N103I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211
AA Change: N103I

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187605
Predicted Effect probably benign
Transcript: ENSMUST00000187900
AA Change: N159I

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211
AA Change: N159I

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188381
AA Change: N115I

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140538
Gene: ENSMUSG00000056211
AA Change: N115I

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
R3H 107 184 3.18e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189317
AA Change: N145I

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140175
Gene: ENSMUSG00000056211
AA Change: N145I

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
R3H 137 214 1.9e-24 SMART
Pfam:SUZ 235 287 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194793
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
R7168:R3hdm1 UTSW 1 128216495 missense probably benign 0.05
R7210:R3hdm1 UTSW 1 128211208 missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128182211 splice site probably null
R7896:R3hdm1 UTSW 1 128168966 splice site probably null
R7979:R3hdm1 UTSW 1 128168966 splice site probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTATAACAGCCCATGTCATG -3'
(R):5'- GGTGAATTCCTATTCCTGAAAATGC -3'

Sequencing Primer
(F):5'- AGTTGACAAATAGTGGTTATCTGTC -3'
(R):5'- TTCCTATTCCTGAAAATGCCTAAAG -3'
Posted On2017-08-16