Incidental Mutation 'R6123:Thumpd1'
ID485832
Institutional Source Beutler Lab
Gene Symbol Thumpd1
Ensembl Gene ENSMUSG00000030942
Gene NameTHUMP domain containing 1
Synonyms6330575P11Rik
MMRRC Submission 044270-MU
Accession Numbers

Genbank: NM_145585; MGI: 2444479

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119715093-119720798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119717009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 239 (V239E)
Ref Sequence ENSEMBL: ENSMUSP00000033236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033236] [ENSMUST00000047045]
Predicted Effect probably damaging
Transcript: ENSMUST00000033236
AA Change: V239E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033236
Gene: ENSMUSG00000030942
AA Change: V239E

DomainStartEndE-ValueType
THUMP 161 254 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047045
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209175
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Thumpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL01151:Thumpd1 APN 7 119718195 missense probably damaging 0.97
IGL01327:Thumpd1 APN 7 119720702 missense probably benign 0.12
IGL02140:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL02945:Thumpd1 APN 7 119716747 missense possibly damaging 0.48
F6893:Thumpd1 UTSW 7 119720576 nonsense probably null
R4153:Thumpd1 UTSW 7 119720593 missense probably damaging 1.00
R4934:Thumpd1 UTSW 7 119716779 missense probably benign 0.00
R5475:Thumpd1 UTSW 7 119720720 missense probably benign
R5631:Thumpd1 UTSW 7 119720602 missense probably damaging 1.00
R6292:Thumpd1 UTSW 7 119720674 missense probably benign 0.38
R6351:Thumpd1 UTSW 7 119720605 missense possibly damaging 0.94
R7565:Thumpd1 UTSW 7 119716862 nonsense probably null
R8139:Thumpd1 UTSW 7 119720585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACTTTCAGGTTCAGGTTTAGCG -3'
(R):5'- TTGTCAGTCACAAAGAACAGTG -3'

Sequencing Primer
(F):5'- GGGGATCACTCTGACTCAACTTG -3'
(R):5'- GGAATGAAAGCCTTGTGTG -3'
Posted On2017-08-16