Incidental Mutation 'R6123:Igf2bp1'
ID485841
Institutional Source Beutler Lab
Gene Symbol Igf2bp1
Ensembl Gene ENSMUSG00000013415
Gene Nameinsulin-like growth factor 2 mRNA binding protein 1
SynonymsIMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95957163-96005940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95975296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000013559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013559]
Predicted Effect probably damaging
Transcript: ENSMUST00000013559
AA Change: V122A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415
AA Change: V122A

DomainStartEndE-ValueType
RRM 3 71 7.42e-9 SMART
RRM 82 152 5.25e-9 SMART
KH 194 265 7.75e-14 SMART
KH 275 348 7.34e-15 SMART
low complexity region 377 390 N/A INTRINSIC
KH 404 475 1.91e-13 SMART
KH 486 558 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152896
Meta Mutation Damage Score 0.3385 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Igf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Igf2bp1 APN 11 95974168 missense probably damaging 0.97
IGL03263:Igf2bp1 APN 11 95966673 missense probably damaging 1.00
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0098:Igf2bp1 UTSW 11 95973163 missense probably damaging 1.00
R0348:Igf2bp1 UTSW 11 95968893 missense possibly damaging 0.59
R0534:Igf2bp1 UTSW 11 95966796 splice site probably benign
R2025:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2026:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2103:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R2104:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R5021:Igf2bp1 UTSW 11 95974006 missense probably damaging 0.98
R5154:Igf2bp1 UTSW 11 95963547 nonsense probably null
R6130:Igf2bp1 UTSW 11 95974020 missense probably damaging 1.00
R6736:Igf2bp1 UTSW 11 95973122 missense probably benign 0.14
R7173:Igf2bp1 UTSW 11 95968464 missense probably benign
R7748:Igf2bp1 UTSW 11 95967587 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGTTCCCAGGGACCCAAAAG -3'
(R):5'- TTCCCAGGGTAAGTTTGCTTC -3'

Sequencing Primer
(F):5'- TTCCTGCAGATCATTTTTACTGAG -3'
(R):5'- CCAGGGTAAGTTTGCTTCCAGTG -3'
Posted On2017-08-16