Incidental Mutation 'R6123:Fastkd3'
ID485846
Institutional Source Beutler Lab
Gene Symbol Fastkd3
Ensembl Gene ENSMUSG00000021532
Gene NameFAST kinase domains 3
Synonyms2310010B21Rik
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location68582234-68592338 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 68590218 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 32 (Q32*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051784] [ENSMUST00000223319]
Predicted Effect probably null
Transcript: ENSMUST00000051784
AA Change: Q629*
SMART Domains Protein: ENSMUSP00000061737
Gene: ENSMUSG00000021532
AA Change: Q629*

DomainStartEndE-ValueType
low complexity region 178 189 N/A INTRINSIC
Pfam:FAST_1 410 478 2.9e-22 PFAM
Pfam:FAST_2 491 581 3.1e-28 PFAM
RAP 594 651 7.58e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221006
Predicted Effect probably null
Transcript: ENSMUST00000221640
AA Change: Q32*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222068
Predicted Effect probably benign
Transcript: ENSMUST00000222685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223128
Predicted Effect probably benign
Transcript: ENSMUST00000223319
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of Fas-activated serine/threonine kinase domain (FASTKD) containing proteins that share an amino terminal mitochondrial targeting domain and multiple carboxy terminal FAST domains as well as a putative RNA-binding RAP domain. The members of this family are ubiquitously expressed and are generally most abundant in mitochondria-enriched tissues such as heart, skeletal muscle and brown-adipose tissue. Some members of this protein family may play a role in apoptosis. The protein encoded by this gene interacts with components of the mitochondrial respiratory and translation networks. A pseudogene of this gene is also present on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slitrk3 T C 3: 73,049,762 D559G probably damaging Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Fastkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Fastkd3 APN 13 68584528 missense possibly damaging 0.87
IGL01839:Fastkd3 APN 13 68584852 missense probably benign 0.19
IGL02268:Fastkd3 APN 13 68583677 missense probably damaging 0.96
IGL03412:Fastkd3 APN 13 68583721 missense probably benign 0.01
R0681:Fastkd3 UTSW 13 68591928 splice site probably benign
R1282:Fastkd3 UTSW 13 68584557 missense possibly damaging 0.76
R1987:Fastkd3 UTSW 13 68585241 missense possibly damaging 0.92
R3081:Fastkd3 UTSW 13 68584868 missense probably benign 0.38
R4153:Fastkd3 UTSW 13 68590138 missense probably damaging 1.00
R5339:Fastkd3 UTSW 13 68590164 missense probably damaging 1.00
R5384:Fastkd3 UTSW 13 68584585 missense probably benign 0.09
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6034:Fastkd3 UTSW 13 68583610 missense probably damaging 0.99
R6109:Fastkd3 UTSW 13 68590218 nonsense probably null
R6124:Fastkd3 UTSW 13 68590218 nonsense probably null
R6299:Fastkd3 UTSW 13 68587736 missense probably damaging 0.97
R6388:Fastkd3 UTSW 13 68590200 missense probably damaging 1.00
R6561:Fastkd3 UTSW 13 68584030 missense possibly damaging 0.95
R7214:Fastkd3 UTSW 13 68589380 missense probably benign 0.12
R7446:Fastkd3 UTSW 13 68591960 missense unknown
Predicted Primers PCR Primer
(F):5'- GACACATAGAGCTAGTAAGGTGTAC -3'
(R):5'- GCTAGCAATGCACAAGTGAAAC -3'

Sequencing Primer
(F):5'- AGCTAGTAAGGTGTACTTTGAATCG -3'
(R):5'- TGAAACTAGGGGCATTCCTAC -3'
Posted On2017-08-16