Incidental Mutation 'R6124:Cxcr4'
ID485853
Institutional Source Beutler Lab
Gene Symbol Cxcr4
Ensembl Gene ENSMUSG00000045382
Gene Namechemokine (C-X-C motif) receptor 4
Synonymsfusin, Cmkar4, CD184, Sdf1r, b2b220Clo, PB-CKR
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R6124 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location128588199-128592293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128589660 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 86 (L86P)
Ref Sequence ENSEMBL: ENSMUSP00000120153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052172] [ENSMUST00000142893]
Predicted Effect probably damaging
Transcript: ENSMUST00000052172
AA Change: L88P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053489
Gene: ENSMUSG00000045382
AA Change: L88P

DomainStartEndE-ValueType
Pfam:CXCR4_N 8 40 2.1e-18 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.5e-7 PFAM
Pfam:7tm_1 57 309 2.4e-52 PFAM
low complexity region 344 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142893
AA Change: L86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120153
Gene: ENSMUSG00000045382
AA Change: L86P

DomainStartEndE-ValueType
Pfam:CXCR4_N 6 38 1.5e-24 PFAM
Pfam:7TM_GPCR_Srsx 49 270 2.4e-8 PFAM
Pfam:7tm_1 55 272 1.9e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants exhibit altered viability, lungs, kidneys, immune system, hematopoiesis, myelopoiesis, cerebellar foliation, neuronal cell layer development, susceptibility to diet-induced obesity and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Epg5 A G 18: 78,030,045 N2428D probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Lonrf1 T A 8: 36,229,200 N565I probably damaging Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nlrp6 T A 7: 140,923,247 V422E probably damaging Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Ptgfrn C T 3: 101,073,089 E312K probably damaging Het
Serpinb1b T C 13: 33,093,813 V343A probably benign Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Cxcr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Cxcr4 APN 1 128589055 missense probably damaging 1.00
IGL01343:Cxcr4 APN 1 128589555 missense probably damaging 1.00
IGL03202:Cxcr4 APN 1 128588904 missense probably damaging 1.00
Rubber_ducky UTSW 1 128589450 missense probably damaging 1.00
R1728:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1729:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1730:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1739:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1762:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1783:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1784:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1785:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R2356:Cxcr4 UTSW 1 128589514 missense probably damaging 1.00
R5199:Cxcr4 UTSW 1 128589546 missense probably damaging 1.00
R5472:Cxcr4 UTSW 1 128589625 missense probably damaging 1.00
R5969:Cxcr4 UTSW 1 128589847 missense probably benign
R6211:Cxcr4 UTSW 1 128589450 missense probably damaging 1.00
R6228:Cxcr4 UTSW 1 128592183 splice site probably null
R6349:Cxcr4 UTSW 1 128589277 missense possibly damaging 0.78
R6458:Cxcr4 UTSW 1 128589094 missense probably benign 0.05
R6949:Cxcr4 UTSW 1 128589615 missense probably benign
R7230:Cxcr4 UTSW 1 128589790 missense probably damaging 0.98
R7715:Cxcr4 UTSW 1 128589742 missense probably damaging 1.00
R8040:Cxcr4 UTSW 1 128589798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACTGCCTTTTCAGCCAG -3'
(R):5'- AACAAGGAACCCTGCTTCCG -3'

Sequencing Primer
(F):5'- AGCCAGCAGTTTCCTTGG -3'
(R):5'- TCCGGGATGAAAACGTCCATTTC -3'
Posted On2017-08-16