Incidental Mutation 'R6124:Ptgfrn'
ID 485860
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6124 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101073089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 312 (E312K)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: E312K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: E312K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200065
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cxcr4 A G 1: 128,589,660 L86P probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Epg5 A G 18: 78,030,045 N2428D probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Lonrf1 T A 8: 36,229,200 N565I probably damaging Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nlrp6 T A 7: 140,923,247 V422E probably damaging Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Serpinb1b T C 13: 33,093,813 V343A probably benign Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCCCGAGTTTTCTTTGC -3'
(R):5'- GCACTTTCAACTGTACAAAGCC -3'

Sequencing Primer
(F):5'- TGCTAACATCTCGCACCAGTAGATG -3'
(R):5'- ATCAACCTAAAGGGGCGAC -3'
Posted On 2017-08-16