Mutagenetix > Incidental Mutations

Incidental Mutation 'R6124:Ptgfrn'

485860

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

044271-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6124 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101073089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 312 (E312K)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: E312K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: E312K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200065

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	G	T	3: 92,869,058	P106Q	probably damaging	Het
2900026A02Rik	T	C	5: 113,183,756	N864S	probably benign	Het
Ank2	C	T	3: 127,248,151	V35M	probably benign	Het
Apc2	T	C	10: 80,306,351	M368T	probably damaging	Het
Atp8b3	G	A	10: 80,529,681	T413M	probably damaging	Het
Cxcr4	A	G	1: 128,589,660	L86P	probably damaging	Het
Cyfip1	A	G	7: 55,897,943	Y598C	probably benign	Het
Epg5	A	G	18: 78,030,045	N2428D	probably benign	Het
Fastkd3	C	T	13: 68,590,218	Q32*	probably null	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gm156	A	T	6: 129,768,135	F166Y	probably benign	Het
Gm5422	A	G	10: 31,249,400		noncoding transcript	Het
Gm9913	T	A	2: 125,506,473		probably benign	Het
Hgfac	A	G	5: 35,044,384	N287S	probably benign	Het
Hook3	A	T	8: 26,059,272	N181K	probably benign	Het
Hormad1	A	G	3: 95,576,302	T142A	probably benign	Het
Lonrf1	T	A	8: 36,229,200	N565I	probably damaging	Het
Mast1	A	G	8: 84,925,307	S349P	probably benign	Het
Mcee	T	A	7: 64,400,275	N51K	probably damaging	Het
Mfsd6	A	C	1: 52,708,252	F485V	probably damaging	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nlrp6	T	A	7: 140,923,247	V422E	probably damaging	Het
Nrap	A	G	19: 56,386,026	S23P	probably damaging	Het
Nsd2	T	A	5: 33,843,266	H42Q	probably benign	Het
Obscn	A	T	11: 59,079,044	S91T	probably benign	Het
Olfr1337	C	A	4: 118,782,195	C130F	probably damaging	Het
Olfr215	T	C	6: 116,582,485	I154V	probably benign	Het
Olfr418	T	A	1: 173,270,279	Y35N	probably damaging	Het
Olfr497	A	T	7: 108,423,518		probably null	Het
Olfr53	A	T	7: 140,652,594	D205V	probably damaging	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Papss2	T	A	19: 32,637,128	N81K	probably damaging	Het
Plekhn1	A	G	4: 156,225,239	I147T	possibly damaging	Het
Serpinb1b	T	C	13: 33,093,813	V343A	probably benign	Het
Sis	T	C	3: 72,953,211	N261S	possibly damaging	Het
Slc41a2	T	C	10: 83,297,252	N310S	probably damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Snrnp48	T	A	13: 38,216,463	I182N	possibly damaging	Het
Tppp2	A	T	14: 51,919,480	T105S	probably benign	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Vmn1r19	A	C	6: 57,404,617	M52L	probably benign	Het
Vmn2r94	T	A	17: 18,244,059	R656S	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGCCCGAGTTTTCTTTGC -3'
(R):5'- GCACTTTCAACTGTACAAAGCC -3'

Sequencing Primer
(F):5'- TGCTAACATCTCGCACCAGTAGATG -3'
(R):5'- ATCAACCTAAAGGGGCGAC -3'

Posted On

2017-08-16