Incidental Mutation 'R6124:Nlrp6'
ID485876
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene NameNLR family, pyrin domain containing 6
SynonymsNalp6
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6124 (G1)
Quality Score175.009
Status Not validated
Chromosome7
Chromosomal Location140920902-140929192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140923247 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 422 (V422E)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
Predicted Effect probably damaging
Transcript: ENSMUST00000106045
AA Change: V392E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: V392E

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably damaging
Transcript: ENSMUST00000183845
AA Change: V392E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: V392E

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: V422E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: V422E

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cxcr4 A G 1: 128,589,660 L86P probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Epg5 A G 18: 78,030,045 N2428D probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Lonrf1 T A 8: 36,229,200 N565I probably damaging Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Ptgfrn C T 3: 101,073,089 E312K probably damaging Het
Serpinb1b T C 13: 33,093,813 V343A probably benign Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2097:Nlrp6 UTSW 7 140923204 missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140921655 missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5442:Nlrp6 UTSW 7 140922190 missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140922812 nonsense probably null
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140923841 missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140922830 missense possibly damaging 0.83
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCTTGCTAGTGACTACAC -3'
(R):5'- ATGATGATCCAGGATGCCCTCC -3'

Sequencing Primer
(F):5'- TGACTACACGCCATGCCG -3'
(R):5'- AGCATGCTGGTGATGAAG -3'
Posted On2017-08-16