Incidental Mutation 'R6124:Lonrf1'
ID485878
Institutional Source Beutler Lab
Gene Symbol Lonrf1
Ensembl Gene ENSMUSG00000039633
Gene NameLON peptidase N-terminal domain and ring finger 1
Synonyms
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6124 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location36216064-36249516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36229200 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 565 (N565I)
Ref Sequence ENSEMBL: ENSMUSP00000066403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065297]
Predicted Effect probably damaging
Transcript: ENSMUST00000065297
AA Change: N565I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633
AA Change: N565I

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cxcr4 A G 1: 128,589,660 L86P probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Epg5 A G 18: 78,030,045 N2428D probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nlrp6 T A 7: 140,923,247 V422E probably damaging Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Ptgfrn C T 3: 101,073,089 E312K probably damaging Het
Serpinb1b T C 13: 33,093,813 V343A probably benign Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Lonrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lonrf1 APN 8 36230077 splice site probably benign
IGL02195:Lonrf1 APN 8 36219948 nonsense probably null
IGL03087:Lonrf1 APN 8 36225551 splice site probably null
IGL03163:Lonrf1 APN 8 36230330 missense probably benign 0.03
IGL03225:Lonrf1 APN 8 36222701 missense probably damaging 0.96
BB009:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
BB019:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R0480:Lonrf1 UTSW 8 36222710 missense probably damaging 1.00
R0504:Lonrf1 UTSW 8 36231159 missense possibly damaging 0.93
R0557:Lonrf1 UTSW 8 36230420 missense probably benign 0.12
R1489:Lonrf1 UTSW 8 36222954 missense probably damaging 1.00
R1572:Lonrf1 UTSW 8 36233972 missense probably benign 0.02
R2225:Lonrf1 UTSW 8 36236098 missense probably damaging 0.98
R2345:Lonrf1 UTSW 8 36222862 critical splice donor site probably null
R4821:Lonrf1 UTSW 8 36219972 missense probably benign
R4934:Lonrf1 UTSW 8 36233949 missense probably damaging 1.00
R5538:Lonrf1 UTSW 8 36223024 critical splice acceptor site probably null
R6485:Lonrf1 UTSW 8 36229134 critical splice donor site probably null
R6603:Lonrf1 UTSW 8 36222941 missense probably damaging 1.00
R6886:Lonrf1 UTSW 8 36229037 splice site probably null
R7113:Lonrf1 UTSW 8 36230510 missense probably benign 0.01
R7689:Lonrf1 UTSW 8 36248764 nonsense probably null
R7711:Lonrf1 UTSW 8 36249221 missense probably damaging 1.00
R7743:Lonrf1 UTSW 8 36249052 missense possibly damaging 0.72
R7932:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R8085:Lonrf1 UTSW 8 36248615 missense probably damaging 1.00
R8183:Lonrf1 UTSW 8 36222665 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CGAGGATTCATAATTCACCTCACTC -3'
(R):5'- ATGCCTCTAAGCCATGGTTC -3'

Sequencing Primer
(F):5'- CTCTGAAAATGAAACCACGCTTTCTG -3'
(R):5'- GATATCTGAGATGTGCCTCCCAAAG -3'
Posted On2017-08-16