Incidental Mutation 'R6124:Serpinb1b'
ID 485887
Institutional Source Beutler Lab
Gene Symbol Serpinb1b
Ensembl Gene ENSMUSG00000051029
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonyms ovalbumin, EIB, 6330533H24Rik
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R6124 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33078575-33094380 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33093813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000016951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016951]
AlphaFold Q8VHP7
Predicted Effect probably benign
Transcript: ENSMUST00000016951
AA Change: V343A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016951
Gene: ENSMUSG00000051029
AA Change: V343A

DomainStartEndE-ValueType
SERPIN 13 382 9e-182 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cxcr4 A G 1: 128,589,660 L86P probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Epg5 A G 18: 78,030,045 N2428D probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Lonrf1 T A 8: 36,229,200 N565I probably damaging Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nlrp6 T A 7: 140,923,247 V422E probably damaging Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Ptgfrn C T 3: 101,073,089 E312K probably damaging Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Serpinb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Serpinb1b APN 13 33093867 missense probably damaging 1.00
IGL01348:Serpinb1b APN 13 33091415 missense probably benign 0.25
IGL01413:Serpinb1b APN 13 33093859 missense probably damaging 0.98
IGL01942:Serpinb1b APN 13 33085311 missense possibly damaging 0.69
IGL02065:Serpinb1b APN 13 33091318 missense possibly damaging 0.66
IGL02707:Serpinb1b APN 13 33091665 missense probably benign 0.41
IGL03149:Serpinb1b APN 13 33085292 missense possibly damaging 0.90
R0087:Serpinb1b UTSW 13 33085319 missense probably benign 0.02
R0279:Serpinb1b UTSW 13 33093713 missense possibly damaging 0.81
R0448:Serpinb1b UTSW 13 33089692 missense probably benign 0.01
R1605:Serpinb1b UTSW 13 33093663 missense possibly damaging 0.82
R1628:Serpinb1b UTSW 13 33093654 missense probably benign 0.00
R1955:Serpinb1b UTSW 13 33085439 missense probably benign 0.08
R6632:Serpinb1b UTSW 13 33087455 missense probably damaging 0.97
R7205:Serpinb1b UTSW 13 33087423 missense probably benign 0.07
R7296:Serpinb1b UTSW 13 33093827 missense probably benign 0.30
R7475:Serpinb1b UTSW 13 33093565 missense probably benign 0.01
R7624:Serpinb1b UTSW 13 33091639 splice site probably null
R7958:Serpinb1b UTSW 13 33089653 missense possibly damaging 0.90
R8058:Serpinb1b UTSW 13 33085310 missense probably benign 0.01
R8325:Serpinb1b UTSW 13 33093601 missense probably benign
R8738:Serpinb1b UTSW 13 33087517 missense probably damaging 1.00
R9001:Serpinb1b UTSW 13 33093760 missense probably benign
R9184:Serpinb1b UTSW 13 33085410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTGATGTCCATGTCAAATTGCC -3'
(R):5'- GGGAATGAAATGCTAAGCTCTG -3'

Sequencing Primer
(F):5'- GTCAAATTGCCCAGGTTCAAG -3'
(R):5'- GGAATGAAATGCTAAGCTCTGCCTTC -3'
Posted On 2017-08-16