Incidental Mutation 'R6124:Epg5'
ID485893
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 044271-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R6124 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78030045 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 2428 (N2428D)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably benign
Transcript: ENSMUST00000044622
AA Change: N2428D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: N2428D

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,058 P106Q probably damaging Het
2900026A02Rik T C 5: 113,183,756 N864S probably benign Het
Ank2 C T 3: 127,248,151 V35M probably benign Het
Apc2 T C 10: 80,306,351 M368T probably damaging Het
Atp8b3 G A 10: 80,529,681 T413M probably damaging Het
Cxcr4 A G 1: 128,589,660 L86P probably damaging Het
Cyfip1 A G 7: 55,897,943 Y598C probably benign Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm156 A T 6: 129,768,135 F166Y probably benign Het
Gm5422 A G 10: 31,249,400 noncoding transcript Het
Gm9913 T A 2: 125,506,473 probably benign Het
Hgfac A G 5: 35,044,384 N287S probably benign Het
Hook3 A T 8: 26,059,272 N181K probably benign Het
Hormad1 A G 3: 95,576,302 T142A probably benign Het
Lonrf1 T A 8: 36,229,200 N565I probably damaging Het
Mast1 A G 8: 84,925,307 S349P probably benign Het
Mcee T A 7: 64,400,275 N51K probably damaging Het
Mfsd6 A C 1: 52,708,252 F485V probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nlrp6 T A 7: 140,923,247 V422E probably damaging Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Nsd2 T A 5: 33,843,266 H42Q probably benign Het
Obscn A T 11: 59,079,044 S91T probably benign Het
Olfr1337 C A 4: 118,782,195 C130F probably damaging Het
Olfr215 T C 6: 116,582,485 I154V probably benign Het
Olfr418 T A 1: 173,270,279 Y35N probably damaging Het
Olfr497 A T 7: 108,423,518 probably null Het
Olfr53 A T 7: 140,652,594 D205V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Papss2 T A 19: 32,637,128 N81K probably damaging Het
Plekhn1 A G 4: 156,225,239 I147T possibly damaging Het
Ptgfrn C T 3: 101,073,089 E312K probably damaging Het
Serpinb1b T C 13: 33,093,813 V343A probably benign Het
Sis T C 3: 72,953,211 N261S possibly damaging Het
Slc41a2 T C 10: 83,297,252 N310S probably damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Snrnp48 T A 13: 38,216,463 I182N possibly damaging Het
Tppp2 A T 14: 51,919,480 T105S probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vmn1r19 A C 6: 57,404,617 M52L probably benign Het
Vmn2r94 T A 17: 18,244,059 R656S probably benign Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCTTTGCCTGGCGTATG -3'
(R):5'- TGCACTGCACCTCTATCAGC -3'

Sequencing Primer
(F):5'- AGAAATCCGCCTGCCTCTG -3'
(R):5'- TGCACCTCTATCAGCAGCAG -3'
Posted On2017-08-16