Incidental Mutation 'R6091:Ifnb1'
ID485913
Institutional Source Beutler Lab
Gene Symbol Ifnb1
Ensembl Gene ENSMUSG00000048806
Gene Nameinterferon beta 1, fibroblast
SynonymsIFNB, interferon beta 1, fibroblast, Ifb, IFN-beta
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location88522025-88522774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88522576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 67 (M67L)
Ref Sequence ENSEMBL: ENSMUSP00000056720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055671]
PDB Structure
THREE-DIMENSIONAL CRYSTAL STRUCTURE OF RECOMBINANT MURINE INTERFERON-BETA [X-RAY DIFFRACTION]
Crystal structure of recombinant murine interferon beta [X-RAY DIFFRACTION]
[]
Murine Ifnar1 in complex with interferon-beta [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000055671
AA Change: M67L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056720
Gene: ENSMUSG00000048806
AA Change: M67L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IFabd 56 170 3.87e-49 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit enhanced proliferation and reduced TNF-alpha production by activated T lymphocytes, a defect in B cell maturation, fewer circulating granulocytes and macrophages, and increased viral susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Ifnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ifnb1 APN 4 88522243 missense probably benign 0.01
IGL02434:Ifnb1 APN 4 88522518 missense probably damaging 1.00
IGL02725:Ifnb1 APN 4 88522630 missense probably benign 0.02
R0375:Ifnb1 UTSW 4 88522744 missense probably benign 0.33
R0395:Ifnb1 UTSW 4 88522529 missense possibly damaging 0.95
R2063:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2064:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2065:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2066:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R7499:Ifnb1 UTSW 4 88522674 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACATCTCCCACGTCAATC -3'
(R):5'- TCCATCATGAACAACAGGTGG -3'

Sequencing Primer
(F):5'- GACATCTCCCACGTCAATCTTTCC -3'
(R):5'- TGAACAACAGGTGGATCCTC -3'
Posted On2017-08-16