Incidental Mutation 'R6091:Ints2'
ID 485936
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 044248-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6091 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86236603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 501 (V501E)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: V501E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: V501E

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: V501E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: V501E

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 (GRCm38) T50P possibly damaging Het
Adad1 A G 3: 37,084,969 (GRCm38) E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 (GRCm38) C232S probably damaging Het
AI606181 T C 19: 41,593,624 (GRCm38) S78P unknown Het
Amph T A 13: 19,125,123 (GRCm38) M457K probably benign Het
Ano1 A T 7: 144,669,434 (GRCm38) M174K probably benign Het
C3 T A 17: 57,221,967 (GRCm38) K632* probably null Het
Cep170 C T 1: 176,755,831 (GRCm38) G994D probably damaging Het
Chd7 T C 4: 8,751,875 (GRCm38) V124A probably damaging Het
Chd9 A G 8: 91,035,063 (GRCm38) K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 (GRCm38) T137A unknown Het
Dcc C T 18: 71,809,114 (GRCm38) V311I probably benign Het
Ddx42 A T 11: 106,234,970 (GRCm38) Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 (GRCm38) T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 (GRCm38) I203T probably benign Het
Frem1 A G 4: 82,900,559 (GRCm38) I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 (GRCm38) V546A probably damaging Het
Gbp11 G T 5: 105,331,388 (GRCm38) T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 (GRCm38) P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 (GRCm38) M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 (GRCm38) N50S probably benign Het
Ikzf4 G A 10: 128,634,673 (GRCm38) T326I probably benign Het
Mfsd1 C A 3: 67,599,937 (GRCm38) probably null Het
Mroh2a GCCC GC 1: 88,232,257 (GRCm38) probably null Het
Mrps11 G A 7: 78,788,718 (GRCm38) A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 (GRCm38) E311G probably damaging Het
Mx2 A G 16: 97,546,435 (GRCm38) T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 (GRCm38) L1495R probably damaging Het
Myo3b A G 2: 70,238,769 (GRCm38) T451A probably benign Het
Myrfl T C 10: 116,849,206 (GRCm38) T90A probably benign Het
Nbeal1 A G 1: 60,181,556 (GRCm38) probably benign Het
Ncor1 A G 11: 62,419,617 (GRCm38) L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 (GRCm38) L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 (GRCm38) probably benign Het
Or5aq1b T A 2: 87,071,361 (GRCm38) S258C probably benign Het
Plscr5 A G 9: 92,204,384 (GRCm38) T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 (GRCm38) T525I probably benign Het
Ptprg G A 14: 12,215,979 (GRCm38) G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 (GRCm38) R326G probably damaging Het
Ryr1 T C 7: 29,071,973 (GRCm38) T2541A probably benign Het
Sall1 A G 8: 89,028,619 (GRCm38) L1244P probably damaging Het
Sec16a G A 2: 26,426,470 (GRCm38) H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 (GRCm38) I44T probably benign Het
Snap91 T A 9: 86,839,628 (GRCm38) N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 (GRCm38) T338A possibly damaging Het
Taf6l T C 19: 8,778,556 (GRCm38) T243A probably benign Het
Tex10 T C 4: 48,459,891 (GRCm38) R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 (GRCm38) T391N probably damaging Het
Tnxb G A 17: 34,710,364 (GRCm38) V2794M probably damaging Het
Ush2a T G 1: 188,399,803 (GRCm38) C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 (GRCm38) I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 (GRCm38) I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 (GRCm38) D610G probably benign Het
Wbp1 T C 6: 83,119,487 (GRCm38) S229G probably benign Het
Xirp1 A G 9: 120,017,963 (GRCm38) V618A probably benign Het
Zbtb32 A G 7: 30,591,829 (GRCm38) S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 (GRCm38) S348P probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,233,135 (GRCm38) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,233,183 (GRCm38) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,215,578 (GRCm38) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,213,062 (GRCm38) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,249,287 (GRCm38) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,249,287 (GRCm38) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,234,749 (GRCm38) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,248,851 (GRCm38) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,233,196 (GRCm38) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,244,463 (GRCm38) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,233,085 (GRCm38) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,233,085 (GRCm38) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,233,085 (GRCm38) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,249,248 (GRCm38) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,226,781 (GRCm38) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,226,781 (GRCm38) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,233,085 (GRCm38) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,217,800 (GRCm38) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,248,934 (GRCm38) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,248,934 (GRCm38) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,243,001 (GRCm38) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,242,952 (GRCm38) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,242,952 (GRCm38) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,256,198 (GRCm38) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,249,275 (GRCm38) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,249,275 (GRCm38) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,256,209 (GRCm38) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,212,653 (GRCm38) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,256,200 (GRCm38) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,249,274 (GRCm38) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,215,795 (GRCm38) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,242,947 (GRCm38) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,238,312 (GRCm38) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,215,545 (GRCm38) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,222,174 (GRCm38) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,250,972 (GRCm38) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,226,748 (GRCm38) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,238,468 (GRCm38) missense probably damaging 1.00
R6209:Ints2 UTSW 11 86,225,058 (GRCm38) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,226,661 (GRCm38) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,212,779 (GRCm38) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,233,085 (GRCm38) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,217,754 (GRCm38) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,217,842 (GRCm38) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,233,226 (GRCm38) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,215,618 (GRCm38) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,232,055 (GRCm38) missense probably benign
R7804:Ints2 UTSW 11 86,212,663 (GRCm38) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,238,263 (GRCm38) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,213,062 (GRCm38) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,222,217 (GRCm38) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,244,627 (GRCm38) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,255,353 (GRCm38) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,212,660 (GRCm38) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,215,570 (GRCm38) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,225,088 (GRCm38) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,255,423 (GRCm38) missense probably benign
R8448:Ints2 UTSW 11 86,255,423 (GRCm38) missense probably benign
R8784:Ints2 UTSW 11 86,225,115 (GRCm38) nonsense probably null
R8784:Ints2 UTSW 11 86,222,137 (GRCm38) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,212,894 (GRCm38) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,215,704 (GRCm38) missense probably benign
R9154:Ints2 UTSW 11 86,234,698 (GRCm38) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,244,485 (GRCm38) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,226,763 (GRCm38) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,242,998 (GRCm38) missense
R9476:Ints2 UTSW 11 86,244,509 (GRCm38) missense probably benign
R9510:Ints2 UTSW 11 86,244,509 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGGACCCACTCAAAGTTTTC -3'
(R):5'- GGTTCTACTTCAGTGTCTTAATGTC -3'

Sequencing Primer
(F):5'- GGACCCACTCAAAGTTTTCAAGAATC -3'
(R):5'- CTTAATGTCAGGCTTGAGAGGTCAC -3'
Posted On 2017-08-16