Mutagenetix > Incidental Mutation

Incidental Mutation 'R6091:Amph'

485939

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

044248-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

R6091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19125123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 457 (M457K)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably benign
Transcript: ENSMUST00000003345
AA Change: M453K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: M453K

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197545

Predicted Effect

probably benign
Transcript: ENSMUST00000200466
AA Change: M457K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: M457K

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222698

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	G	2: 35,362,336	T50P	possibly damaging	Het
Adad1	A	G	3: 37,084,969	E396G	possibly damaging	Het
Adamtsl3	T	A	7: 82,465,621	C232S	probably damaging	Het
AI606181	T	C	19: 41,593,624	S78P	unknown	Het
Ano1	A	T	7: 144,669,434	M174K	probably benign	Het
C3	T	A	17: 57,221,967	K632*	probably null	Het
Cep170	C	T	1: 176,755,831	G994D	probably damaging	Het
Chd7	T	C	4: 8,751,875	V124A	probably damaging	Het
Chd9	A	G	8: 91,035,063	K2259E	probably damaging	Het
Col7a1	A	G	9: 108,955,334	T137A	unknown	Het
Dcc	C	T	18: 71,809,114	V311I	probably benign	Het
Ddx42	A	T	11: 106,234,970	Q282L	probably damaging	Het
Fcgbp	A	G	7: 28,104,965	T1833A	possibly damaging	Het
Fpr-rs3	A	G	17: 20,624,270	I203T	probably benign	Het
Frem1	A	G	4: 82,900,559	I2139T	probably benign	Het
Frmpd2	T	C	14: 33,522,863	V546A	probably damaging	Het
Gbp11	G	T	5: 105,331,388	T123N	possibly damaging	Het
Hs3st1	G	A	5: 39,614,664	P212L	probably damaging	Het
Ifnb1	T	A	4: 88,522,576	M67L	probably benign	Het
Ighv1-54	T	C	12: 115,193,877	N50S	probably benign	Het
Ikzf4	G	A	10: 128,634,673	T326I	probably benign	Het
Ints2	A	T	11: 86,236,603	V501E	probably damaging	Het
Mfsd1	C	A	3: 67,599,937		probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mrps11	G	A	7: 78,788,718	A73T	possibly damaging	Het
Mterf4	T	C	1: 93,301,569	E311G	probably damaging	Het
Mx2	A	G	16: 97,546,435	T176A	probably damaging	Het
Mycbp2	A	C	14: 103,223,046	L1495R	probably damaging	Het
Myo3b	A	G	2: 70,238,769	T451A	probably benign	Het
Myrfl	T	C	10: 116,849,206	T90A	probably benign	Het
Nbeal1	A	G	1: 60,181,556		probably benign	Het
Ncor1	A	G	11: 62,419,617	L201P	probably damaging	Het
Nfxl1	G	T	5: 72,514,190	L909I	probably benign	Het
Nr3c1	GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC	GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC	18: 39,486,958		probably benign	Het
Olfr1107	T	A	2: 87,071,361	S258C	probably benign	Het
Plscr5	A	G	9: 92,204,384	T136A	probably benign	Het
Ppp1r3a	G	A	6: 14,719,340	T525I	probably benign	Het
Ptprg	G	A	14: 12,215,979	G1143R	probably damaging	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Ryr1	T	C	7: 29,071,973	T2541A	probably benign	Het
Sall1	A	G	8: 89,028,619	L1244P	probably damaging	Het
Sec16a	G	A	2: 26,426,470	H1673Y	probably damaging	Het
Slc22a19	A	G	19: 7,711,063	I44T	probably benign	Het
Snap91	T	A	9: 86,839,628	N53Y	probably damaging	Het
Sorcs1	T	C	19: 50,288,101	T338A	possibly damaging	Het
Taf6l	T	C	19: 8,778,556	T243A	probably benign	Het
Tex10	T	C	4: 48,459,891	R487G	probably damaging	Het
Tfcp2	G	T	15: 100,512,313	T391N	probably damaging	Het
Tnxb	G	A	17: 34,710,364	V2794M	probably damaging	Het
Ush2a	T	G	1: 188,399,803	C741G	probably damaging	Het
Vmn1r3	T	A	4: 3,184,684	I208F	probably damaging	Het
Vmn2r28	T	A	7: 5,493,791	I21F	possibly damaging	Het
Vmn2r93	A	G	17: 18,325,696	D610G	probably benign	Het
Wbp1	T	C	6: 83,119,487	S229G	probably benign	Het
Xirp1	A	G	9: 120,017,963	V618A	probably benign	Het
Zbtb32	A	G	7: 30,591,829	S14P	possibly damaging	Het
Zfp24	A	G	18: 24,014,212	S348P	probably damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9717:Amph	UTSW	13	19125083	missense	probably benign	0.07
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TCAGAATGATGCGGAGATTCTGG -3'
(R):5'- GCTACATGGCAGTTTCCCTAATG -3'

Sequencing Primer
(F):5'- GGTTGTCCAGAATTCTGCAATGTC -3'
(R):5'- GGCAGTTTCCCTAATGCATAAG -3'

Posted On

2017-08-16