Incidental Mutation 'R6091:Tfcp2'
ID485943
Institutional Source Beutler Lab
Gene Symbol Tfcp2
Ensembl Gene ENSMUSG00000009733
Gene Nametranscription factor CP2
SynonymsTcfcp2, CP-2, D230015P20Rik, LBP1, UBP-1, CP2, LSF, LBP-1c, LBP-1d
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6091 (G1)
Quality Score203.009
Status Validated
Chromosome15
Chromosomal Location100498012-100552008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100512313 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 391 (T391N)
Ref Sequence ENSEMBL: ENSMUSP00000155683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009877] [ENSMUST00000229581] [ENSMUST00000229696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009877
AA Change: T389N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009877
Gene: ENSMUSG00000009733
AA Change: T389N

DomainStartEndE-ValueType
Pfam:CP2 44 260 8.6e-60 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229581
AA Change: T391N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000229696
AA Change: T391N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000231174
Meta Mutation Damage Score 0.5748 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no apparent alterations in overall behavior, hematopoiesis, globin chain synthesis, or immunological function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Tfcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Tfcp2 APN 15 100513178 unclassified probably benign
IGL00916:Tfcp2 APN 15 100520678 missense probably damaging 1.00
IGL01819:Tfcp2 APN 15 100504439 missense probably benign 0.02
IGL02075:Tfcp2 APN 15 100513180 unclassified probably benign
IGL02370:Tfcp2 APN 15 100512304 missense probably damaging 1.00
IGL02608:Tfcp2 APN 15 100514110 missense possibly damaging 0.48
IGL03001:Tfcp2 APN 15 100528421 missense possibly damaging 0.47
R0153:Tfcp2 UTSW 15 100514827 missense probably damaging 1.00
R2879:Tfcp2 UTSW 15 100551320 unclassified probably null
R3103:Tfcp2 UTSW 15 100525600 missense probably damaging 1.00
R4302:Tfcp2 UTSW 15 100514849 missense possibly damaging 0.77
R4929:Tfcp2 UTSW 15 100528489 missense probably benign 0.29
R4965:Tfcp2 UTSW 15 100525650 missense probably damaging 1.00
R5196:Tfcp2 UTSW 15 100520714 missense probably damaging 1.00
R5407:Tfcp2 UTSW 15 100527874 splice site probably null
R6136:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R7241:Tfcp2 UTSW 15 100518587 missense possibly damaging 0.95
R7808:Tfcp2 UTSW 15 100522429 missense probably damaging 1.00
X0011:Tfcp2 UTSW 15 100513080 critical splice donor site probably null
X0040:Tfcp2 UTSW 15 100518598 missense probably damaging 1.00
X0063:Tfcp2 UTSW 15 100512301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAATTGACAGGAACAGCTAGAAG -3'
(R):5'- AGCTTAAATGGCGCCTCCTG -3'

Sequencing Primer
(F):5'- GGATCTAGAATTCCAACTAACGCTG -3'
(R):5'- GCGCCTCCTGTTGCAAAGAATC -3'
Posted On2017-08-16