Incidental Mutation 'R6092:BC034090'
ID485961
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission 044249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6092 (G1)
Quality Score219.009
Status Validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155224913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 535 (D535V)
Ref Sequence ENSEMBL: ENSMUSP00000037456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035914] [ENSMUST00000186156] [ENSMUST00000187096]
Predicted Effect probably damaging
Transcript: ENSMUST00000035914
AA Change: D535V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037456
Gene: ENSMUSG00000033722
AA Change: D535V

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:DUF4685 44 168 6.6e-57 PFAM
low complexity region 486 500 N/A INTRINSIC
low complexity region 562 568 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
PDZ 830 905 4.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186082
Predicted Effect possibly damaging
Transcript: ENSMUST00000186156
AA Change: D897V

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: D897V

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186551
Predicted Effect probably benign
Transcript: ENSMUST00000187096
SMART Domains Protein: ENSMUSP00000140632
Gene: ENSMUSG00000033722

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190976
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAACACTGGCTAACTTGC -3'
(R):5'- TGTCCCCTCCAAGAACTGTG -3'

Sequencing Primer
(F):5'- GAACACTGGCTAACTTGCTCCATG -3'
(R):5'- TGGTTCTCACGCGACCC -3'
Posted On2017-08-16