Incidental Mutation 'R6092:Plch2'
ID485977
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 044249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6092 (G1)
Quality Score191.009
Status Validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154984372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1266 (T1266A)
Ref Sequence ENSEMBL: ENSMUSP00000101256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953] [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably benign
Transcript: ENSMUST00000030931
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070953
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105631
AA Change: T1266A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: T1266A

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect probably benign
Transcript: ENSMUST00000124517
SMART Domains Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 1 77 1.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect probably benign
Transcript: ENSMUST00000135665
AA Change: T1161A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: T1161A

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139976
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148934
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175982
AA Change: T1014A
Predicted Effect probably benign
Transcript: ENSMUST00000176194
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176620
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
R7844:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R7927:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R8003:Plch2 UTSW 4 155054523 missense not run
R8007:Plch2 UTSW 4 155002831 missense not run
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGTCTCCCAGACTCTTG -3'
(R):5'- ACGGGCACTGACAGGTTATG -3'

Sequencing Primer
(F):5'- GACTCTTGGACTTAGCAGACACTG -3'
(R):5'- ACAGGTTATGGCAGCGGC -3'
Posted On2017-08-16