Incidental Mutation 'R6093:Phyh'
ID486022
Institutional Source Beutler Lab
Gene Symbol Phyh
Ensembl Gene ENSMUSG00000026664
Gene Namephytanoyl-CoA hydroxylase
SynonymsLnap1
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6093 (G1)
Quality Score124.008
Status Not validated
Chromosome2
Chromosomal Location4919019-4938730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4919085 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 6 (A6S)
Ref Sequence ENSEMBL: ENSMUSP00000027975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027975]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027975
AA Change: A6S

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027975
Gene: ENSMUSG00000026664
AA Change: A6S

DomainStartEndE-ValueType
Pfam:PhyH 61 277 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high phytol diet, mice homozygous for a null allele exhibit hepatic lipidosis and steatosis, ataxia, peripheral neuropathy and loss of spermatogonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Phyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Phyh APN 2 4930793 missense probably null 1.00
R0552:Phyh UTSW 2 4936101 missense probably damaging 1.00
R1624:Phyh UTSW 2 4925683 missense probably benign 0.11
R1656:Phyh UTSW 2 4938353 missense probably damaging 0.97
R1721:Phyh UTSW 2 4937809 missense probably null 0.24
R3161:Phyh UTSW 2 4937671 splice site probably benign
R5353:Phyh UTSW 2 4942201 unclassified probably benign
R5907:Phyh UTSW 2 4930651 intron probably null
R6188:Phyh UTSW 2 4927490 missense probably damaging 0.96
R6394:Phyh UTSW 2 4936003 missense probably benign 0.02
R7316:Phyh UTSW 2 4936044 nonsense probably null
X0060:Phyh UTSW 2 4938350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGACTCCAGACAGCCTAG -3'
(R):5'- TAGAGAAGTCCCACCAGAGAGC -3'

Sequencing Primer
(F):5'- AGGCTCGCTCCCTCATC -3'
(R):5'- TTCCAGAAGACGAGGGCTCTC -3'
Posted On2017-08-16