Incidental Mutation 'R6093:Dcaf17'
ID486026
Institutional Source Beutler Lab
Gene Symbol Dcaf17
Ensembl Gene ENSMUSG00000041966
Gene NameDDB1 and CUL4 associated factor 17
Synonyms
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71055328-71099142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71082012 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 314 (K314E)
Ref Sequence ENSEMBL: ENSMUSP00000099762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064141] [ENSMUST00000102701] [ENSMUST00000112159] [ENSMUST00000112167] [ENSMUST00000135357] [ENSMUST00000154704]
Predicted Effect probably benign
Transcript: ENSMUST00000064141
AA Change: K314E

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000102701
AA Change: K314E

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect silent
Transcript: ENSMUST00000112159
Predicted Effect probably benign
Transcript: ENSMUST00000112167
Predicted Effect unknown
Transcript: ENSMUST00000130292
AA Change: K328E
SMART Domains Protein: ENSMUSP00000117830
Gene: ENSMUSG00000041966
AA Change: K328E

DomainStartEndE-ValueType
Pfam:DCAF17 55 405 6.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132619
Predicted Effect probably benign
Transcript: ENSMUST00000135357
SMART Domains Protein: ENSMUSP00000118011
Gene: ENSMUSG00000041966

DomainStartEndE-ValueType
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136299
Predicted Effect probably benign
Transcript: ENSMUST00000154704
AA Change: K314E

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Dcaf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dcaf17 APN 2 71078159 missense probably benign 0.03
IGL01125:Dcaf17 APN 2 71089805 missense probably benign 0.03
IGL01761:Dcaf17 APN 2 71056537 missense probably damaging 1.00
IGL02641:Dcaf17 APN 2 71082031 missense probably damaging 1.00
R0081:Dcaf17 UTSW 2 71078468 splice site probably benign
R0388:Dcaf17 UTSW 2 71078571 missense probably benign 0.02
R0593:Dcaf17 UTSW 2 71087400 critical splice donor site probably null
R0637:Dcaf17 UTSW 2 71060419 missense probably damaging 0.99
R0661:Dcaf17 UTSW 2 71088435 missense probably damaging 1.00
R1281:Dcaf17 UTSW 2 71078156 missense probably damaging 1.00
R1454:Dcaf17 UTSW 2 71073173 missense probably damaging 1.00
R1501:Dcaf17 UTSW 2 71081988 missense probably damaging 1.00
R1908:Dcaf17 UTSW 2 71060369 nonsense probably null
R1919:Dcaf17 UTSW 2 71078172 splice site probably null
R2882:Dcaf17 UTSW 2 71082027 missense possibly damaging 0.96
R4585:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R4586:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R7070:Dcaf17 UTSW 2 71088513 missense probably benign 0.00
R8289:Dcaf17 UTSW 2 71055374 missense
R8418:Dcaf17 UTSW 2 71088373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAATGACGGGTGCAAGTC -3'
(R):5'- GGGTGACAAAACACTATTTCCTG -3'

Sequencing Primer
(F):5'- GTGCAAGTCCAACCAGAATG -3'
(R):5'- ACATGCCTTTAATCCCAGCATTGG -3'
Posted On2017-08-16