Incidental Mutation 'R6093:Tmod4'
ID486029
Institutional Source Beutler Lab
Gene Symbol Tmod4
Ensembl Gene ENSMUSG00000005628
Gene Nametropomodulin 4
SynonymsMTMOD, skeletal tropomodulin, Sk-Tmod
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95124476-95129209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95125618 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 22 (T22S)
Ref Sequence ENSEMBL: ENSMUSP00000116341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000009102] [ENSMUST00000107227] [ENSMUST00000131597] [ENSMUST00000172572] [ENSMUST00000173462]
Predicted Effect probably benign
Transcript: ENSMUST00000005769
AA Change: T22S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628
AA Change: T22S

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000009102
SMART Domains Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958

DomainStartEndE-ValueType
Pfam:YL1 5 216 5.1e-58 PFAM
low complexity region 247 264 N/A INTRINSIC
YL1_C 294 323 5.99e-9 SMART
low complexity region 335 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
AA Change: T22S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628
AA Change: T22S

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
AA Change: T22S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628
AA Change: T22S

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149898
Predicted Effect probably benign
Transcript: ENSMUST00000172572
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173462
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199730
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no overt myopathy, with normal thin filament lengths, myofibril organization, and skeletal muscle contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Tmod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Tmod4 APN 3 95125580 missense probably damaging 1.00
IGL01339:Tmod4 APN 3 95128297 missense probably benign 0.23
IGL01785:Tmod4 APN 3 95125618 missense probably benign
IGL02160:Tmod4 APN 3 95129113 unclassified probably benign
IGL02303:Tmod4 APN 3 95125642 missense probably benign 0.24
2107:Tmod4 UTSW 3 95130168 unclassified probably null
R0042:Tmod4 UTSW 3 95129788 missense possibly damaging 0.90
R1515:Tmod4 UTSW 3 95128679 missense possibly damaging 0.76
R4210:Tmod4 UTSW 3 95127829 missense probably benign 0.00
R4211:Tmod4 UTSW 3 95127829 missense probably benign 0.00
R6181:Tmod4 UTSW 3 95127807 missense probably damaging 1.00
R6294:Tmod4 UTSW 3 95128306 missense probably benign 0.05
R6351:Tmod4 UTSW 3 95127853 missense probably damaging 1.00
R7417:Tmod4 UTSW 3 95125863 missense possibly damaging 0.87
R7806:Tmod4 UTSW 3 95127604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGTGTCCTAACTATGGC -3'
(R):5'- AGCTGGCAAGAGCATGTTC -3'

Sequencing Primer
(F):5'- CAGTGTCCTAACTATGGCTGGAC -3'
(R):5'- TTGGGGAACAAATTAAGCACTCTCC -3'
Posted On2017-08-16