Incidental Mutation 'R6093:Tmem167b'
ID486031
Institutional Source Beutler Lab
Gene Symbol Tmem167b
Ensembl Gene ENSMUSG00000068732
Gene Nametransmembrane protein 167B
Synonyms
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108556425-108562466 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 108562123 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000102233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090546] [ENSMUST00000106622]
Predicted Effect probably benign
Transcript: ENSMUST00000090546
SMART Domains Protein: ENSMUSP00000088035
Gene: ENSMUSG00000068732

DomainStartEndE-ValueType
Pfam:DUF1242 10 46 7.6e-14 PFAM
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106622
AA Change: M1K
SMART Domains Protein: ENSMUSP00000102233
Gene: ENSMUSG00000068732
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 58 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Tmem167b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Tmem167b APN 3 108558906 missense possibly damaging 0.82
R0847:Tmem167b UTSW 3 108560221 missense probably benign
R5310:Tmem167b UTSW 3 108562099 intron probably benign
R5524:Tmem167b UTSW 3 108560253 missense possibly damaging 0.84
R5808:Tmem167b UTSW 3 108560243 missense probably benign 0.27
R6358:Tmem167b UTSW 3 108558895 missense possibly damaging 0.94
R7716:Tmem167b UTSW 3 108558897 missense probably damaging 1.00
R8922:Tmem167b UTSW 3 108560225 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATAACAGCTTCTCTCCCCTGGG -3'
(R):5'- TTGCGTACTACGGCTCGTTC -3'

Sequencing Primer
(F):5'- TCCCCTGGGGACTAACAACATAATTC -3'
(R):5'- ATTTGCAGCCGCCACAG -3'
Posted On2017-08-16