Incidental Mutation 'R6093:Atp2a1'
ID486043
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 044250-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126446921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 977 (V977A)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]
Predicted Effect probably damaging
Transcript: ENSMUST00000032974
AA Change: V977A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: V977A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106405
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106407
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Predicted Effect unknown
Transcript: ENSMUST00000146973
AA Change: V121A
SMART Domains Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730
AA Change: V121A

DomainStartEndE-ValueType
Pfam:Cation_ATPase_C 6 132 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1748:Atp2a1 UTSW 7 126459608 missense possibly damaging 0.67
R1799:Atp2a1 UTSW 7 126450142 missense probably benign 0.27
R1808:Atp2a1 UTSW 7 126453401 missense probably damaging 0.97
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R2427:Atp2a1 UTSW 7 126446583 makesense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
R7206:Atp2a1 UTSW 7 126447972 missense probably benign 0.01
R7354:Atp2a1 UTSW 7 126448856 missense probably damaging 1.00
R7363:Atp2a1 UTSW 7 126462889 missense possibly damaging 0.88
R7501:Atp2a1 UTSW 7 126450172 missense probably benign 0.29
R7560:Atp2a1 UTSW 7 126459656 missense possibly damaging 0.95
R7716:Atp2a1 UTSW 7 126462187 missense possibly damaging 0.86
R7772:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTTATCCTATGGCCAGAGAG -3'
(R):5'- TGCAGAGCATGTGTCCACAG -3'

Sequencing Primer
(F):5'- TCATAGCTGGAGTGGGGAC -3'
(R):5'- ATGTGTCCACAGGGTGCTCAC -3'
Posted On2017-08-16