Mutagenetix > Incidental Mutations

Incidental Mutation 'R6093:Ano1'

486044

Institutional Source

Beutler Lab

Gene Symbol

Ano1

Ensembl Gene

ENSMUSG00000031075

Gene Name

anoctamin 1, calcium activated chloride channel

Synonyms

Tmem16a

MMRRC Submission

044250-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6093 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144588549-144751974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144611377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 648 (N648S)

Ref Sequence

ENSEMBL: ENSMUSP00000112616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033393
AA Change: N587S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: N587S

Domain	Start	End	E-Value	Type
low complexity region	129	147	N/A	INTRINSIC
Pfam:Anoctamin	320	898	1.3e-149	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118556
AA Change: N645S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: N645S

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	112	375	5.5e-83	PFAM
Pfam:Anoctamin	378	955	6.7e-140	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121758
AA Change: N648S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: N648S

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	54	317	7.1e-83	PFAM
Pfam:Anoctamin	320	901	2.2e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131571

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	G	2: 68,659,870		probably benign	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Adgrl3	A	C	5: 81,646,522	R531S	probably benign	Het
Ahctf1	T	C	1: 179,762,952	D1252G	probably benign	Het
Antxr2	C	A	5: 98,030,460	L30F	probably damaging	Het
Apol9a	T	A	15: 77,404,420	N249I	probably benign	Het
Atp2a1	A	G	7: 126,446,921	V977A	probably damaging	Het
Clmn	T	C	12: 104,771,956	T968A	probably benign	Het
Clstn2	A	T	9: 97,458,210	I703N	probably damaging	Het
Cnot1	T	C	8: 95,748,894	T1051A	probably benign	Het
Csde1	A	G	3: 103,052,902	Y615C	probably damaging	Het
Dcaf17	A	G	2: 71,082,012	K314E	possibly damaging	Het
Dnah10	A	T	5: 124,753,174	I711F	probably benign	Het
Duox1	G	T	2: 122,347,274	R1513L	probably benign	Het
Exph5	A	G	9: 53,372,617	T333A	possibly damaging	Het
Fmnl2	A	G	2: 53,114,868	D658G	probably damaging	Het
Gcgr	T	A	11: 120,538,121	L395Q	probably damaging	Het
Gm10801	C	CGTA	2: 98,663,807		probably null	Het
Gm11487	T	C	4: 73,402,021	I174V	probably benign	Het
Greb1	C	T	12: 16,684,486	C1501Y	probably benign	Het
Iqgap2	A	G	13: 95,628,963	V1533A	probably damaging	Het
Kcnc3	A	C	7: 44,591,508	D208A	probably benign	Het
Kctd14	A	G	7: 97,454,953		probably benign	Het
Mcm5	C	A	8: 75,109,746	D13E	probably benign	Het
Med23	A	G	10: 24,878,443	I221V	probably benign	Het
Myo19	T	C	11: 84,885,709	F64L	probably damaging	Het
Ncapd3	T	G	9: 27,056,158	S597A	probably damaging	Het
Neb	A	T	2: 52,251,770	Y72*	probably null	Het
Nrip1	C	T	16: 76,294,764		probably benign	Het
Olfr196	T	A	16: 59,167,967	M59L	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Phkb	T	A	8: 85,942,329	D328E	probably damaging	Het
Phyh	G	T	2: 4,919,085	A6S	possibly damaging	Het
Pole	A	T	5: 110,312,090	Q1120L	probably benign	Het
Rbmxl1	T	C	8: 78,505,943	Y257C	probably damaging	Het
Smurf2	A	T	11: 106,868,623	H69Q	possibly damaging	Het
Tmem167b	A	T	3: 108,562,123	M1K	probably null	Het
Tmod4	A	T	3: 95,125,618	T22S	probably benign	Het
Triml1	T	C	8: 43,140,718	I149M	probably benign	Het
Vmn2r108	T	C	17: 20,481,140	T33A	probably benign	Het
Vmn2r76	T	A	7: 86,228,261	R525*	probably null	Het
Zfp109	A	T	7: 24,229,133	W292R	probably benign	Het
Zfp292	C	T	4: 34,811,902	A381T	probably damaging	Het
Zfp791	C	T	8: 85,113,506		probably null	Het

Other mutations in Ano1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Ano1	APN	7	144638513	missense	probably damaging	1.00
IGL00754:Ano1	APN	7	144597231	missense	probably damaging	0.98
IGL00780:Ano1	APN	7	144655630	missense	probably damaging	0.99
IGL00918:Ano1	APN	7	144644752	splice site	probably benign
IGL01112:Ano1	APN	7	144637145	missense	possibly damaging	0.52
IGL01285:Ano1	APN	7	144644742	missense	probably benign	0.00
IGL01285:Ano1	APN	7	144595538	missense	probably damaging	0.98
IGL01308:Ano1	APN	7	144595498	missense	probably damaging	0.99
IGL01407:Ano1	APN	7	144637111	missense	probably benign	0.22
IGL01672:Ano1	APN	7	144655675	missense	probably damaging	0.96
IGL01920:Ano1	APN	7	144611454	splice site	probably benign
IGL01926:Ano1	APN	7	144610875	missense	possibly damaging	0.94
IGL02164:Ano1	APN	7	144637181	missense	possibly damaging	0.91
IGL02190:Ano1	APN	7	144618883	missense	probably benign	0.41
IGL02214:Ano1	APN	7	144655708	missense	possibly damaging	0.80
IGL02299:Ano1	APN	7	144590075	missense	possibly damaging	0.80
IGL02567:Ano1	APN	7	144611625	missense	probably damaging	1.00
IGL03131:Ano1	APN	7	144603585	missense	possibly damaging	0.90
IGL03291:Ano1	APN	7	144621675	missense	probably damaging	1.00
IGL03299:Ano1	APN	7	144654256	missense	probably damaging	1.00
IGL03394:Ano1	APN	7	144595439	splice site	probably null
PIT4434001:Ano1	UTSW	7	144610895	missense	probably benign	0.28
R0502:Ano1	UTSW	7	144597215	missense	probably damaging	1.00
R0595:Ano1	UTSW	7	144590153	missense	possibly damaging	0.94
R0732:Ano1	UTSW	7	144619488	critical splice acceptor site	probably null
R0970:Ano1	UTSW	7	144595571	missense	probably benign	0.02
R0988:Ano1	UTSW	7	144633653	missense	possibly damaging	0.94
R1074:Ano1	UTSW	7	144611680	missense	probably damaging	0.98
R1301:Ano1	UTSW	7	144633689	missense	possibly damaging	0.60
R1528:Ano1	UTSW	7	144595566	missense	probably damaging	1.00
R2018:Ano1	UTSW	7	144654250	missense	probably damaging	1.00
R2056:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2057:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2058:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2059:Ano1	UTSW	7	144611390	missense	probably damaging	1.00
R2860:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R2861:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R3770:Ano1	UTSW	7	144595569	missense	probably damaging	1.00
R3970:Ano1	UTSW	7	144607963	missense	probably benign	0.00
R4179:Ano1	UTSW	7	144650505	missense	probably damaging	1.00
R4489:Ano1	UTSW	7	144611742	missense	probably benign	0.00
R4678:Ano1	UTSW	7	144669552	missense	probably benign	0.01
R4915:Ano1	UTSW	7	144611375	missense	possibly damaging	0.69
R5114:Ano1	UTSW	7	144657083	missense	possibly damaging	0.71
R5362:Ano1	UTSW	7	144648600	unclassified	probably benign
R5364:Ano1	UTSW	7	144637204	missense	probably damaging	1.00
R5366:Ano1	UTSW	7	144654209	missense	possibly damaging	0.85
R5387:Ano1	UTSW	7	144648619	missense	probably benign
R5762:Ano1	UTSW	7	144648037	missense	probably damaging	0.99
R5857:Ano1	UTSW	7	144637103	missense	probably benign	0.02
R6091:Ano1	UTSW	7	144669434	missense	probably benign	0.12
R6177:Ano1	UTSW	7	144678741	missense	possibly damaging	0.79
R6246:Ano1	UTSW	7	144633725	missense	possibly damaging	0.82
R6274:Ano1	UTSW	7	144618863	missense	probably benign	0.01
R6323:Ano1	UTSW	7	144611686	missense	possibly damaging	0.95
R6574:Ano1	UTSW	7	144607916	critical splice donor site	probably null
R6782:Ano1	UTSW	7	144621687	missense	probably damaging	1.00
R6880:Ano1	UTSW	7	144644742	missense	probably benign	0.00
R6909:Ano1	UTSW	7	144655731	missense	probably damaging	0.96
R7066:Ano1	UTSW	7	144637086	missense	probably benign	0.35
R7073:Ano1	UTSW	7	144638552	missense	probably damaging	0.96
R7146:Ano1	UTSW	7	144655656	missense	probably benign	0.00
R7420:Ano1	UTSW	7	144655641	missense	probably benign	0.00
R7874:Ano1	UTSW	7	144621724	missense	probably damaging	1.00
R8468:Ano1	UTSW	7	144655620	missense	probably damaging	1.00
R8867:Ano1	UTSW	7	144669660	missense	possibly damaging	0.66
R8923:Ano1	UTSW	7	144650551	missense	possibly damaging	0.61
R9215:Ano1	UTSW	7	144595605	missense	probably damaging	1.00
R9281:Ano1	UTSW	7	144595581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATCTTGGGCTGTGGAAG -3'
(R):5'- TGAAGTTTACGGCTGCATTGC -3'

Sequencing Primer
(F):5'- AAGCTGCACTTCCTGTTTTCC -3'
(R):5'- CCAAGATTGGTGAGTGCCATG -3'

Posted On

2017-08-16