Incidental Mutation 'R6093:Ano1'
ID 486044
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
MMRRC Submission 044250-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6093 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144611377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 648 (N648S)
Ref Sequence ENSEMBL: ENSMUSP00000112616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000033393
AA Change: N587S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: N587S

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118556
AA Change: N645S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: N645S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121758
AA Change: N648S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: N648S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131571
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Csde1 A G 3: 103,052,902 Y615C probably damaging Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCTTGGGCTGTGGAAG -3'
(R):5'- TGAAGTTTACGGCTGCATTGC -3'

Sequencing Primer
(F):5'- AAGCTGCACTTCCTGTTTTCC -3'
(R):5'- CCAAGATTGGTGAGTGCCATG -3'
Posted On 2017-08-16