Incidental Mutation 'R6088:Fam129b'
ID486068
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6088 (G1)
Quality Score171.009
Status Validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32923123 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 540 (V540A)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000028135] [ENSMUST00000113200]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000028135
AA Change: V540A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: V540A

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154514
Meta Mutation Damage Score 0.5426 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7769:Fam129b UTSW 2 32919832 missense possibly damaging 0.93
R7888:Fam129b UTSW 2 32922125 nonsense probably null
R7971:Fam129b UTSW 2 32922125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCAGATCACCATTCCC -3'
(R):5'- AAGCTGGCAGACCACTATG -3'

Sequencing Primer
(F):5'- CATTCCCTTCCTGCTCAAAAAG -3'
(R):5'- GCAGACCACTATGTCCCACTCTG -3'
Posted On2017-08-16