Incidental Mutation 'R6088:Nr5a1'
ID486069
Institutional Source Beutler Lab
Gene Symbol Nr5a1
Ensembl Gene ENSMUSG00000026751
Gene Namenuclear receptor subfamily 5, group A, member 1
SynonymsELP, Ad4BP, SF1, Ftzf1, SF-1, steroidogenic factor 1, adrenal 4-binding protein, Ftz-F1
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location38692656-38714542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38701995 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 322 (D322G)
Ref Sequence ENSEMBL: ENSMUSP00000108504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028084] [ENSMUST00000112883]
Predicted Effect probably benign
Transcript: ENSMUST00000028084
AA Change: D322G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028084
Gene: ENSMUSG00000026751
AA Change: D322G

DomainStartEndE-ValueType
ZnF_C4 10 81 2.41e-38 SMART
low complexity region 124 142 N/A INTRINSIC
low complexity region 195 222 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
HOLI 268 431 3.54e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112883
AA Change: D322G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108504
Gene: ENSMUSG00000026751
AA Change: D322G

DomainStartEndE-ValueType
ZnF_C4 10 81 2.41e-38 SMART
low complexity region 124 142 N/A INTRINSIC
low complexity region 195 222 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
HOLI 268 431 3.54e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149690
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in sex determination. The encoded protein binds DNA as a monomer. Defects in this gene are a cause of XY sex reversal with or without adrenal failure as well as adrenocortical insufficiency without ovarian defect. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit agenesis of the adrenal glands and gonads, defects of the ventromedial hypothalamic nucleus, impaired pituitary gonadotroph function, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Nr5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nr5a1 APN 2 38708341 missense probably benign 0.00
IGL02869:Nr5a1 APN 2 38708129 missense probably benign
IGL03081:Nr5a1 APN 2 38710532 missense possibly damaging 0.92
R0053:Nr5a1 UTSW 2 38694166 missense probably damaging 0.98
R1437:Nr5a1 UTSW 2 38710673 missense probably benign
R1753:Nr5a1 UTSW 2 38708419 missense possibly damaging 0.84
R1921:Nr5a1 UTSW 2 38694096 missense probably damaging 1.00
R3500:Nr5a1 UTSW 2 38707940 nonsense probably null
R4393:Nr5a1 UTSW 2 38694219 missense probably damaging 1.00
R5417:Nr5a1 UTSW 2 38708086 missense possibly damaging 0.95
R5821:Nr5a1 UTSW 2 38708499 missense probably damaging 0.96
R5936:Nr5a1 UTSW 2 38701778 intron probably benign
R6443:Nr5a1 UTSW 2 38710430 missense probably damaging 0.99
R7099:Nr5a1 UTSW 2 38694136 missense probably damaging 1.00
Z1177:Nr5a1 UTSW 2 38710673 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGGAGATCCAATTCCACTG -3'
(R):5'- TCCATCTGAGACTTTGAGCAG -3'

Sequencing Primer
(F):5'- GGGGAGATCCAATTCCACTGTTATC -3'
(R):5'- CATCTGAGACTTTGAGCAGAGAGTTG -3'
Posted On2017-08-16