Incidental Mutation 'R6088:Gucy1b1'
ID486075
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Nameguanylate cyclase 1, soluble, beta 1
Synonymsbeta 1 sGC
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location82032006-82074689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82034880 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 524 (H524R)
Ref Sequence ENSEMBL: ENSMUSP00000142119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
Predicted Effect probably damaging
Transcript: ENSMUST00000029635
AA Change: H524R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: H524R

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192508
Predicted Effect probably damaging
Transcript: ENSMUST00000193597
AA Change: H524R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: H524R

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 82034862 missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 82034868 missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 82035285 missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 82046526 missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 82058329 missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 82039861 missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 82034878 missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 82034391 missense probably benign
R0126:Gucy1b1 UTSW 3 82037911 splice site probably benign
R0277:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 82045460 missense probably benign 0.02
R0691:Gucy1b1 UTSW 3 82045634 splice site probably benign
R0811:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 82045460 missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 82038042 missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 82058352 missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 82045409 missense probably benign 0.43
R1995:Gucy1b1 UTSW 3 82034853 missense probably damaging 1.00
R2156:Gucy1b1 UTSW 3 82061020 missense probably benign
R2441:Gucy1b1 UTSW 3 82045454 missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 82046667 missense probably benign 0.43
R5397:Gucy1b1 UTSW 3 82044151 missense possibly damaging 0.92
R5494:Gucy1b1 UTSW 3 82039876 missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 82058277 missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 82046713 splice site probably null
R6331:Gucy1b1 UTSW 3 82034411 missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 82034408 missense probably benign
R6753:Gucy1b1 UTSW 3 82039747 missense probably null 0.03
R7150:Gucy1b1 UTSW 3 82043162 missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 82033274 missense unknown
R7461:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 82035359 missense probably damaging 1.00
R7613:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7791:Gucy1b1 UTSW 3 82035397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCCACTCGCAAGGTAC -3'
(R):5'- TGTGGATGAGGAAAGCTCCC -3'

Sequencing Primer
(F):5'- CTCGCAAGGTACCAGGCAAATAG -3'
(R):5'- GGATGAGGAAAGCTCCCAATATTTC -3'
Posted On2017-08-16