Incidental Mutation 'R6088:Ptprf'
ID486080
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118210755 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1785 (T1785I)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
PDB Structure
Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049074
AA Change: T1785I

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: T1785I

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123484
Predicted Effect unknown
Transcript: ENSMUST00000124758
AA Change: T1218I
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: T1218I

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127616
Predicted Effect unknown
Transcript: ENSMUST00000150096
AA Change: T1177I
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: T1177I

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184953
Meta Mutation Damage Score 0.2067 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AATGGCTGTGTCAGGAGTCC -3'
(R):5'- CAAGACACTGCAGGGATCTG -3'

Sequencing Primer
(F):5'- AACTTCCCTGGCCTTCGGG -3'
(R):5'- ACACTGCAGGGATCTGAGTCG -3'
Posted On2017-08-16