Incidental Mutation 'R6088:Rcc1'
ID486081
Institutional Source Beutler Lab
Gene Symbol Rcc1
Ensembl Gene ENSMUSG00000028896
Gene Nameregulator of chromosome condensation 1
SynonymsChc1, 4931417M11Rik
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132331919-132353605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132332842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 430 (D430E)
Ref Sequence ENSEMBL: ENSMUSP00000030726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030726] [ENSMUST00000030730] [ENSMUST00000084250] [ENSMUST00000105951] [ENSMUST00000105960] [ENSMUST00000105962] [ENSMUST00000125513] [ENSMUST00000127402] [ENSMUST00000137520] [ENSMUST00000147652] [ENSMUST00000155129]
Predicted Effect probably benign
Transcript: ENSMUST00000030726
AA Change: D430E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030726
Gene: ENSMUSG00000028896
AA Change: D430E

DomainStartEndE-ValueType
Pfam:RCC1 47 95 7.9e-12 PFAM
Pfam:RCC1 98 147 7.5e-17 PFAM
Pfam:RCC1_2 134 165 1.3e-11 PFAM
Pfam:RCC1 150 200 9.9e-10 PFAM
Pfam:RCC1_2 187 216 3.2e-7 PFAM
Pfam:RCC1 203 268 4.2e-14 PFAM
Pfam:RCC1 271 322 1.1e-11 PFAM
Pfam:RCC1 325 373 3.4e-10 PFAM
Pfam:RCC1 376 427 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030730
SMART Domains Protein: ENSMUSP00000030730
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
RRM 97 171 2.2e-11 SMART
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084250
AA Change: D417E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081271
Gene: ENSMUSG00000028896
AA Change: D417E

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105951
AA Change: D417E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101571
Gene: ENSMUSG00000028896
AA Change: D417E

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105960
SMART Domains Protein: ENSMUSP00000101580
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
PDB:2DHG|A 21 70 9e-25 PDB
SCOP:d1fj7a_ 22 70 7e-7 SMART
Blast:RRM 31 70 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105962
SMART Domains Protein: ENSMUSP00000101582
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
PDB:2DHG|A 87 137 7e-24 PDB
SCOP:d1cvja1 97 137 9e-5 SMART
Blast:RRM 97 138 2e-20 BLAST
low complexity region 145 164 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125513
Predicted Effect probably benign
Transcript: ENSMUST00000127402
SMART Domains Protein: ENSMUSP00000120657
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
low complexity region 101 120 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131524
Predicted Effect probably benign
Transcript: ENSMUST00000137520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146166
Predicted Effect probably benign
Transcript: ENSMUST00000147652
SMART Domains Protein: ENSMUSP00000127273
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 1.73e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150959
Predicted Effect probably benign
Transcript: ENSMUST00000155129
SMART Domains Protein: ENSMUSP00000120701
Gene: ENSMUSG00000028896

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 3.9e-13 PFAM
Pfam:RCC1_2 69 98 5.2e-7 PFAM
Pfam:RCC1 85 116 5.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155194
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Rcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02927:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02802:Rcc1 UTSW 4 132337756 missense probably benign 0.20
IGL02837:Rcc1 UTSW 4 132337756 missense probably benign 0.20
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0828:Rcc1 UTSW 4 132335825 unclassified probably benign
R1606:Rcc1 UTSW 4 132334776 unclassified probably null
R2155:Rcc1 UTSW 4 132338049 critical splice donor site probably null
R3721:Rcc1 UTSW 4 132337814 missense possibly damaging 0.46
R4633:Rcc1 UTSW 4 132335769 missense probably damaging 0.98
R4908:Rcc1 UTSW 4 132337753 missense probably damaging 1.00
R4936:Rcc1 UTSW 4 132335735 missense probably damaging 0.96
R5461:Rcc1 UTSW 4 132334186 missense probably benign 0.00
R5627:Rcc1 UTSW 4 132338143 missense probably damaging 0.98
R6197:Rcc1 UTSW 4 132337762 missense possibly damaging 0.58
R6456:Rcc1 UTSW 4 132334116 missense probably benign 0.10
R7127:Rcc1 UTSW 4 132334796 missense probably damaging 0.98
R7440:Rcc1 UTSW 4 132337799 missense probably damaging 0.97
R7529:Rcc1 UTSW 4 132334563 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGTATGTTCTAGAAAGAGGACG -3'
(R):5'- ATCTCCTGGTGTGGAAACGC -3'

Sequencing Primer
(F):5'- TGTTCTAGAAAGAGGACGGACGAAAC -3'
(R):5'- CCAAAGATAGCTGCTTCTATTTCTG -3'
Posted On2017-08-16