Incidental Mutation 'R6088:Mad1l1'
ID486091
Institutional Source Beutler Lab
Gene Symbol Mad1l1
Ensembl Gene ENSMUSG00000029554
Gene NameMAD1 mitotic arrest deficient 1-like 1
SynonymsMad1
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location140008689-140321552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140193963 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 390 (H390L)
Ref Sequence ENSEMBL: ENSMUSP00000106453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]
Predicted Effect probably benign
Transcript: ENSMUST00000031534
AA Change: H390L

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: H390L

DomainStartEndE-ValueType
Pfam:MAD 54 715 1.6e-272 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110829
AA Change: H390L

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: H390L

DomainStartEndE-ValueType
Pfam:MAD 2 511 2.5e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132832
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Mad1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Mad1l1 APN 5 140117277 missense probably benign 0.00
IGL02098:Mad1l1 APN 5 140310589 splice site probably benign
IGL02100:Mad1l1 APN 5 140143934 missense probably damaging 1.00
IGL03131:Mad1l1 APN 5 140307703 missense probably benign 0.18
R0738:Mad1l1 UTSW 5 140300560 missense probably damaging 1.00
R1902:Mad1l1 UTSW 5 140303688 missense possibly damaging 0.57
R1989:Mad1l1 UTSW 5 140303670 missense probably benign 0.27
R2090:Mad1l1 UTSW 5 140009256 missense probably benign 0.01
R2471:Mad1l1 UTSW 5 140261552 missense probably benign 0.43
R4049:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4050:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4096:Mad1l1 UTSW 5 140307673 missense probably benign 0.01
R4682:Mad1l1 UTSW 5 140300252 missense possibly damaging 0.47
R4729:Mad1l1 UTSW 5 140261511 missense possibly damaging 0.76
R4838:Mad1l1 UTSW 5 140300262 nonsense probably null
R5946:Mad1l1 UTSW 5 140261579 missense probably damaging 1.00
R6362:Mad1l1 UTSW 5 140315055 missense possibly damaging 0.71
R6845:Mad1l1 UTSW 5 140009169 missense probably damaging 1.00
R6957:Mad1l1 UTSW 5 140065817 missense probably damaging 0.99
R6983:Mad1l1 UTSW 5 140193984 missense probably damaging 0.99
R7347:Mad1l1 UTSW 5 140144044 missense probably damaging 1.00
U24488:Mad1l1 UTSW 5 140315085 missense probably damaging 1.00
X0026:Mad1l1 UTSW 5 140009205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAAAGCTATGGACCACAGG -3'
(R):5'- GCACGTGCAGCTCTATTTTAG -3'

Sequencing Primer
(F):5'- GCTATGGACCACAGGCAAGC -3'
(R):5'- CACGTGCAGCTCTATTTTAGGATGC -3'
Posted On2017-08-16