Incidental Mutation 'R6088:Olfr396-ps1'
ID486103
Institutional Source Beutler Lab
Gene Symbol Olfr396-ps1
Ensembl Gene ENSMUSG00000086011
Gene Nameolfactory receptor 396, pseudogene 1
SynonymsMOR135-19, GA_x6K02T2P1NL-4083149-4084087
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R6088 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73928007-73928945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73928823 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 273 (T273S)
Ref Sequence ENSEMBL: ENSMUSP00000146203 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000143750
AA Change: T273S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000205791
AA Change: T200S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.2817 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Myo5b T A 18: 74,720,898 L1196Q possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Olfr396-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6683:Olfr396-ps1 UTSW 11 73928113 missense probably damaging 1.00
R6874:Olfr396-ps1 UTSW 11 73928242 missense probably null 0.90
R7024:Olfr396-ps1 UTSW 11 73928506 nonsense probably null
R7336:Olfr396-ps1 UTSW 11 73928837 missense probably benign
R7380:Olfr396-ps1 UTSW 11 73928187 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTCTTATGCACGCATCATC -3'
(R):5'- CATAAGAGTTCTTGTGGGCAGAG -3'

Sequencing Primer
(F):5'- GCATCATCTCCTCCATTCTCAAGG -3'
(R):5'- CAGCCGCAACTGCATTTG -3'
Posted On2017-08-16